Transcript

exosc8-201

ID
ZDB-TSCRIPT-090929-7158
Name
exosc8-201
Previous Names
  • exosc8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024290 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024290|OTTDARG00000019701|ZDB-GENE-030131-1736 exosc8|OTTDARP00000020084 exosc8-001 LG_ CT573139.21 Danio rerio protein_coding KNOWN, 969 bp
ATTCACGTGGTGCTTCCAAACATCATGGCGGCTGGTTTTA
AAACCGCAGAGCCTCTTGAATATCACCGGAGCTTTCTGAA
AGAAAACTGTCGTCCAGATGGAAGGGAGTTGGGAGAGTTT
AGACCCACGACGTTAAATATTAACTCCATATCTACAGCCG
ATGGATCAGCACTGGTGAAAATTGGAAACACTACCGTGAT
CTGTGGGATAAAAGCTGAATTGGCTGTGCCGCCATCTGAG
GCTCAGAATAAAGGATATTTAGTCCCAAATGTAGATCTGC
CCCCGCTGTGCTCGTCCAGATTCAGAGCTGGTCCACCAGG
AGAACAGGCACAGGCTGCCAGCCAGTTCATCGCAGATGTC
ATCGAAAGTTCCGATTTAATAAATTTGGAGGAACTGTGCA
TTGAAAAAGCTAAGCTTTGTTGGGTGCTGTACTGTGATAT
TATGTGTTTGGATTACGATGGGAACTTACTTGACGCCTGC
ATCACAGTTCTGCTGGCAGCTTTAAAAACCGCACAACTCC
CTGAAGTCACCATAAACAAAGAGACAGATCTAGCAGAAGT
TGACATTGAGAAGAAGAGGCGCTTGAAGATCAACCGGCAC
CCAGTCGGCTCATCGTTTGCAGTATTTGATGACTCCATCA
TTATAGTTGACCCCACGGCGGAAGAGGAAAGCTTGTCTAC
AGCATTAATGACTGTGGTGACGGATGAGGAGGATAGACTC
TGTGCAGTTCACAAACCAGGTGGGACATCGTTATCCGGCG
AGAAGCTACAACACTGCATAAACAGAGCCATCACAAGAAA
CAAAGAGATCAGAAAACTGCTGGACAAAGTCCACGAGAGC
ACGAAGACCATGAAATAAACACAGAATCACAATGTTTTGT
TTTTTTTATCTAAAAGTTGTATTTTCACTGTCAATATATA
CTTTCTTTTTTATCACAATAAAACTGCCGACAAAGACCAT
TTACAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations