Transcript

esr2b-004

ID
ZDB-TSCRIPT-090929-17982
Name
esr2b-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037574 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037574|OTTDARG00000027789|ZDB-GENE-030116-1 esr2b|no_translation esr2b-004 LG_ CT025749.9 Danio rerio protein_coding KNOWN, 533 bp
GCTGCATAAAACATACGCTGGATAGGTTGGCATTTCATTC
CGCTGTGACGACCCCAGATTAATAAAGGGAATAAGCTGAA
AAGAAAAAGAATAAGTGAATGGTGTATGGGTGTTTCCTAG
TACTGGGTTGCAGATGAAAGGGCATCCGCTGCATTAGACA
TATGCTGAAATAGTCGGCGATTCATTCCCCTATGGTGACC
CTTGATAGATAAGAGACTAAGCTGAAGGAAAATAAATGAA
TGAATGAATTTCTCTGTGTCGTCTTCAACTGCATCAGGTC
TTGTCCTGTTTTGTGCTGATAAACAGATAACTGTTCGAGT
TTGCCACAGACTCCTGAGGATGTGGAGAGTCGCGGGAAGG
TGCTGAATCTGCTGGACTCAGTGACCGATGCTCTGGTGTG
GATCATCTCCAGAACGGGTCTGTCCTCACAACAACAGTCC
ATCCGGCTCGCTCATCTGCTAATGCTGCTCTCACACATCC
GACACCTCAGCAACAAAGGCATCGAGCATCTGTCAAACAT
GAAGAGGAAAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations