Transcript

esr2b-201

ID
ZDB-TSCRIPT-090929-17980
Name
esr2b-201
Previous Names
  • esr2b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037572 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037572|OTTDARG00000027789|ZDB-GENE-030116-1 esr2b|OTTDARP00000030116 esr2b-002 LG_ CT025749.9 Danio rerio protein_coding KNOWN, 2549 bp
ACCCGAGCTCTCCAGCGCACATCACCTGCTGCCTGCTAAC
GTTGGGCCTGAGATGCAGTAGTGTGTCAGGCCAGGGTCTC
TCTTGTGTTCTCCAGCATGAGCTCCTCCCCTGGACCTGCC
CCTGTCCTGGACTCCAGCAAGGCCGATCGAGGGGCCTCGC
CTGCCCTCTTACCCCGGCTCTACGCCTCCCCGCTCGGCAT
GGACAACCAGACCGTCTGCATTCCTTCCCCATATGTGGAG
GCCTGTCAGGATTACTCTCCACCGCATGGGGGAGAGTTCA
ACCACGGAGCCCTAACGCTCTACAGCCCCGTCTCCTCTGC
AGTGCTCGGCTTCCATCGTCCTCCTGTGTCCGAAAGCCTC
GTCCCGCTTAGTCCCACAATCCTGTGGCCGCCTCACTCTC
TGCACTGCCCGCCTCCGCTGGCCTACAGCGAAACACGTTC
ACACAGCGCCTGGGAGGAGGCCAAGACACACACGCTCAGC
CAGAGCAGTTCTGTCCTTAGTCATACAAAGCTGTTAGGAC
AGCAGCTAGAAGGTGACAATGGCTTGAATCCCTCCGCGAG
CATTGTGGGTAAAGGAGACACTCACTTCTGCGCCGTGTGC
CATGACTACGCTTCTGGATATCACTATGGTGTCTGGTCAT
GTGAAGGGTGCAAGGCTTTCTTCAAGCGTAGCATTCAAGG
TCACAATGACTATATTTGTCCAGCCACCAACCAGTGCACT
ATTGACAAGAGCAGACGCAAGAGCTGTCAGGCCTGTCGAC
TCCGCAAGTGCTATGAAGTGGGCATGATGAAGTGTGGTAT
GCAGCTGACTCTCCGCTTCTGTGTGAGGAGGGAGCGCTGC
AGTTATCGAGGTGCTCGACATCGTCGTAACCCCCAAATCA
GAGACAGCTCTGGCGGGGTGGTAGGACTCAGAGGTCAATC
CCAGCAGCATCTAGAGTTCCCCCTCAGTCCCTCTCAGCAC
CTCTTTCCTTCAGGGGGCAGAGCCGAGGGACGGGGCCTGA
ACTATTCCCCTGAACAATTGGTTAGCTGTATTCTAGAGGC
GGAGCCACCTCAAATTTACCTGAGAGAGCCGGTGAAAAAG
CCATACACTGAGGCTAGCATGATGATGTCACTAACAAGCC
TCGCCGACAAGGAGCTAGTGCTCATGATTAGCTGGGCGAA
GAAGATACCAGGTTTTGTAGAGTTGACTTTGTCAGATCAG
GTGCATTTGCTGGAATGCTGCTGGCTGGATATTCTGATGT
TAGGATTGATGTGGAGATCTGTGGATCATCCTGGGAAACT
CATCTTCACCCCTGACCTCAAGCTCAACAGGGAGGAAGGG
AATTGTGTTGAAGGCATCATGGAGATTTTTGACATGCTGC
TGGCCACCACCTCTCGATTCAGAGAGCTGAAGCTGCAGAG
AGAGGAATACGTCTGTCTCAAAGCCATGATCCTGCTCAAC
TCTAATAACTGTTCGAGTTTGCCACAGACTCCTGAGGATG
TGGAGAGTCGCGGGAAGGTGCTGAATCTGCTGGACTCAGT
GACCGATGCTCTGGTGTGGATCATCTCCAGAACGGGTCTG
TCCTCACAACAACAGTCCATCCGGCTCGCTCATCTGCTAA
TGCTGCTCTCACACATCCGACACCTCAGCAACAAAGGCAT
CGAGCATCTGTCAAACATGAAGAGGAAAAACGTGGTGCTG
CTGTACGATCTTCTGCTAGAGATGCTGGACGCAAACACGT
CTCAGAGCAGCCGGATGCTGGAAGACAGACAACAGAGCCC
AGAAAACCTTCACACATCCAGACCGCAGCCTGACCTGAAA
GACAGCGACCAGGAGACCCCACACAGTCCACGGGCTGAGG
AGACGGTGAACAAGACATTGCATTCTAGTCTGCTTCGAGA
GGACATGGACACAAACTGACAGTCACAGACTTTTGTGGGG
GGGGGGGGGACTCTGGATCTGGCATTTCATTCATCCATCC
ATCAGTTTTCCAGTCTGCATTTTTTGCATGTGGGATTAAG
ACATGAAAAAAGGAACATCAGGTGATCGACGACAACCTGA
ACCAAACAGGGCTTTCAAACAGCACTCAGTCCTGCTTCAA
CACAATGCTACTACAACACTACATTGTTTTCCTTTAACAG
AGGAATCATTCTCATCTCATTTGTTCAAGAAAATCTTCAA
TGAAACATTTTATGGCTCTATCTGGTTCTGTATGTGGTAA
AGGTGAAGTGTGTCATTTCTGTGCCGCTAGAAGAATGAAA
ACAACAACAACAACAACAACAACAACAAGATTCAAACACT
CCCAAAGTCTGCCATTGCAACCAGGAAGCCCAGCCCCAAA
AATCACACCATTGGCTGAGACAGTTACATAGCGTTTATTT
TGTTTTAATCAAACTGTAAATGTTTCTTTTGCCATCCAAG
ATTTCAGACTGAACTATTGATTAACGAAAACGGTGCGCAC
ACTTCTAATAGTTTATGCATTTTGTACTTTGTGTTTCTGT
AAGTCGTTGGAATGTCATTTGCTGTCCTGTAGTGCTTTTC
GTGGTTTATAAAGTACTTGTCATTGACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations