Morpholino

MO3-grk4

ID

ZDB-MRPHLNO-240613-1

Name

MO3-grk4

Previous Names

None

Target

grk4 (1)

Sequence

5' - GTCAGAAGAAAGATCCCATGCAGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-grk4

No data available

Phenotype

Phenotype resulting from MO3-grk4

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	WT + MO3-grk4	Figure 3 , Figure 5 , Figure 6 from Vu et al., 2026
pronephric distal early tubule increased length, abnormal	WT + MO3-grk4	Figure 1 , Figure 3 from Vu et al., 2026
pronephric distal late tubule decreased length, abnormal	WT + MO3-grk4	Figure 1 from Vu et al., 2026
pronephric glomerulus cystic, abnormal	WT + MO3-grk4	Figure 3 , Figure 4 , Figure 5 , Figure 6 from Vu et al., 2026 Fig. 1, Fig. 4, Fig. 5, Fig. 6 from Gerhards et al., 2023
pronephric glomerulus increased size, abnormal	WT + MO3-grk4	Figure 1 , Figure 3 from Vu et al., 2026
pronephric proximal convoluted tubule decreased length, abnormal	WT + MO3-grk4	Figure 1 from Vu et al., 2026
pronephric proximal straight tubule increased length, abnormal	WT + MO3-grk4	Figure 1 , Figure 3 from Vu et al., 2026
pronephric tubule dilated, abnormal	WT + MO3-grk4	Figure 3 from Vu et al., 2026
pronephric tubule slc9a3.1 expression increased amount, abnormal	WT + MO3-grk4	Figure 2 , Figure 4 from Vu et al., 2026
pronephric tubule increased diameter, abnormal	WT + MO3-grk4	Fig. 2 from Gerhards et al., 2023
pronephric tubule slc9a3.1 expression increased distribution, abnormal	WT + MO3-grk4	Figure 2 , Figure 5 , Figure 6 from Vu et al., 2026
pronephric tubule cilium increased length, abnormal	WT + MO3-grk4	Figure 3 from Vu et al., 2026 Fig. 2, Fig. 5, Fig. 6 from Gerhards et al., 2023
urine protein increased amount, abnormal	WT + MO3-grk4	Fig. 1 from Gerhards et al., 2023
ventricular system swollen, abnormal	WT + MO3-grk4	Fig. 1, Fig. 4, Fig. 5 from Gerhards et al., 2023
whole organism ab9-rps6 labeling increased amount, abnormal	WT + MO3-grk4	Fig. 6 from Gerhards et al., 2023
whole organism positive regulation of receptor signaling pathway via STAT increased magnitude, abnormal	WT + MO3-grk4	Figure 6 from Vu et al., 2026

Phenotype of all Fish created by or utilizing MO3-grk4

Phenotype	Fish	Conditions	Figures
pronephric glomerulus cystic, ameliorated	WT + MO3-grk4	chemical treatment by environment: tenapanor	Figure 3 from Vu et al., 2026
pronephric distal late tubule decreased length, abnormal	WT + MO3-grk4	standard conditions	Figure 1 from Vu et al., 2026
pronephric glomerulus cystic, abnormal	WT + MO3-grk4	chemical treatment by environment: ecopipam hydrochloride	Figure 4 from Vu et al., 2026
whole organism ab9-rps6 labeling increased amount, abnormal	WT + MO3-grk4	control	Fig. 6 from Gerhards et al., 2023
pronephric tubule dilated, abnormal	WT + MO3-grk4	control	Figure 3 from Vu et al., 2026
pronephric proximal straight tubule increased length, abnormal	WT + MO3-grk4	standard conditions	Figure 1 , Figure 3 from Vu et al., 2026
pronephric tubule slc9a3.1 expression increased distribution, abnormal	WT + MO3-grk4	standard conditions	Figure 2 , Figure 5 , Figure 6 from Vu et al., 2026
pronephric tubule slc9a3.1 expression increased amount, abnormal	WT + MO3-grk4	standard conditions	Figure 2 , Figure 4 from Vu et al., 2026
pronephric tubule cilium length, ameliorated	WT + MO3-grk4	chemical treatment by environment: sirolimus	Fig. 6 from Gerhards et al., 2023
ventricular system swollen, abnormal	WT + MO3-grk4	control	Fig. 1, Fig. 4, Fig. 5 from Gerhards et al., 2023
pronephric tubule cilium increased length, abnormal	WT + MO3-grk4	control	Figure 3 from Vu et al., 2026 Fig. 2, Fig. 5, Fig. 6 from Gerhards et al., 2023
pronephric distal early tubule increased length, abnormal	WT + MO3-grk4	standard conditions	Figure 1 , Figure 3 from Vu et al., 2026
pronephric glomerulus cystic, abnormal	WT + MO3-grk4	control	Figure 3 , Figure 4 , Figure 5 , Figure 6 from Vu et al., 2026
pronephric tubule dilated, ameliorated	WT + MO3-grk4	chemical treatment by environment: tenapanor	Figure 3 from Vu et al., 2026
urine protein increased amount, abnormal	WT + MO3-grk4	control	Fig. 1 from Gerhards et al., 2023
pronephric tubule cilium length, ameliorated	WT + MO3-grk4	chemical treatment by environment: tenapanor	Figure 3 from Vu et al., 2026
pronephric tubule increased diameter, abnormal	WT + MO3-grk4	control	Fig. 2 from Gerhards et al., 2023
pronephric proximal straight tubule length, ameliorated	WT + MO3-grk4	chemical treatment by environment: tenapanor	Figure 3 from Vu et al., 2026
pronephric glomerulus size, ameliorated	WT + MO3-grk4	chemical treatment by environment: tenapanor	Figure 3 from Vu et al., 2026
brain hydrocephalic, ameliorated	WT + MO3-grk4	chemical treatment by environment: tenapanor	Figure 3 from Vu et al., 2026
pronephric distal early tubule length, ameliorated	WT + MO3-grk4	chemical treatment by environment: tenapanor	Figure 3 from Vu et al., 2026
pronephric proximal convoluted tubule decreased length, abnormal	WT + MO3-grk4	standard conditions	Figure 1 from Vu et al., 2026
pronephric glomerulus increased size, abnormal	WT + MO3-grk4	standard conditions	Figure 1 , Figure 3 from Vu et al., 2026
pronephric tubule slc9a3.1 expression increased amount, abnormal	WT + MO3-grk4	chemical treatment by environment: ecopipam hydrochloride	Figure 4 from Vu et al., 2026
brain hydrocephalic, abnormal	WT + MO3-grk4	standard conditions	Figure 3 , Figure 5 , Figure 6 from Vu et al., 2026
whole organism positive regulation of receptor signaling pathway via STAT increased magnitude, abnormal	WT + MO3-grk4	standard conditions	Figure 6 from Vu et al., 2026
pronephric glomerulus cystic, abnormal	li1Tg + MO3-grk4	control	Fig. 1, Fig. 4, Fig. 5, Fig. 6 from Gerhards et al., 2023
pronephric glomerulus morphology, ameliorated	li1Tg + MO3-grk4	chemical treatment by environment: sirolimus	Fig. 6 from Gerhards et al., 2023

Citations