Morpholino
MO6-lmna
- ID
- ZDB-MRPHLNO-240229-1
- Name
- MO6-lmna
- Previous Names
- None
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - CATGGTTGTCTGGAACTACTGATAA - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            Translation blocking MO
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO6-lmna
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO6-lmna
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    
                
                    
                        Phenotype of all Fish created by or utilizing MO6-lmna
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| heart contraction decreased rate of continuous process, abnormal | WT + MO6-lmna | control | Figure 4  from Elfatih et al., 2022 | 
| heart contraction increased rate of continuous process, abnormal | WT + MO6-lmna | control | Figure 4  from Elfatih et al., 2022 | 
| atrioventricular valve morphology, abnormal | sd2Tg; zf3671Tg + MO6-lmna | control | Figure 5  from Elfatih et al., 2022 | 
| atrium shape, abnormal | sd2Tg; zf3671Tg + MO6-lmna | control | Figure 5  from Elfatih et al., 2022 | 
| cardiac ventricle shape, abnormal | sd2Tg; zf3671Tg + MO6-lmna | control | Figure 5  from Elfatih et al., 2022 | 
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    