Morpholino

MO1-pax1a

ID
ZDB-MRPHLNO-230502-3
Name
MO1-pax1a
Previous Names
None
Target
Sequence
5' - TGTTTGCTCCATTTGCTTTTGCGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pax1a
Expressed Gene Anatomy Figures
dlx2a Fig. 6 with image,  Fig. 7 with image from Liu et al., 2020
edn1 Fig. 10 with image from Liu et al., 2020
fgf3 Fig. 10 with image from Liu et al., 2020
hand2 Fig. 6 with image from Liu et al., 2020
nkx2.3 Fig. 9 with image from Liu et al., 2020
tbx1 Fig. 10 with image from Liu et al., 2020
Phenotype
Phenotype resulting from MO1-pax1a
Phenotype Fish Figures
ceratobranchial 1 cartilage absent, abnormal WT + MO1-pax1a Fig. 4 with image from Liu et al., 2020
ceratobranchial 2 cartilage absent, abnormal WT + MO1-pax1a Fig. 4 with image from Liu et al., 2020
ceratobranchial 2 cartilage decreased length, abnormal WT + MO1-pax1a Fig. 4 with image from Liu et al., 2020
ceratobranchial 3 cartilage absent, abnormal WT + MO1-pax1a Fig. 4 with image from Liu et al., 2020
ceratobranchial 3 cartilage decreased length, abnormal WT + MO1-pax1a Fig. 4 with image from Liu et al., 2020
ceratobranchial 4 cartilage absent, abnormal WT + MO1-pax1a Fig. 4 with image from Liu et al., 2020
Phenotype of all Fish created by or utilizing MO1-pax1a
Phenotype Fish Conditions Figures
ceratobranchial 3 cartilage absent, abnormal WT + MO1-pax1a standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 2 cartilage absent, abnormal WT + MO1-pax1a standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 4 cartilage absent, abnormal WT + MO1-pax1a standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 3 cartilage decreased length, abnormal WT + MO1-pax1a standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 1 cartilage absent, abnormal WT + MO1-pax1a standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 2 cartilage decreased length, abnormal WT + MO1-pax1a standard conditions Fig. 4 with image from Liu et al., 2020
pharyngeal pouch 3 tbx1 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 3 fgf3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal arch 3 hand2 expression decreased amount, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal arch 3 dlx2a expression decreased amount, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 5 nkx2.3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 5 edn1 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 2 nkx2.3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 4 tbx1 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal arch 4 dlx2a expression decreased amount, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal arch 4 hand2 expression decreased amount, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 1 fgf3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
ceratobranchial cartilage absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 5 with image from Liu et al., 2020
pharyngeal pouch 5 tbx1 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 3 edn1 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 5 fgf3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal arch 6 dlx2a expression decreased amount, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal arch 5 hand2 expression decreased amount, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 4 nkx2.3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 2 edn1 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 2 fgf3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 2 tbx1 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 4 fgf3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 4 edn1 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal arch 6 hand2 expression decreased amount, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal arch 5 dlx2a expression decreased amount, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 3 nkx2.3 expression absent, abnormal pax1bas37/as37 + MO1-pax1a standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal arch 4 dlx2a expression decreased amount, abnormal WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 7 with image from Liu et al., 2020
ceratobranchial 2 cartilage absent, exacerbated WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 3 cartilage decreased length, exacerbated WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 2 cartilage decreased length, exacerbated WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 4 with image from Liu et al., 2020
ceratohyal cartilage inverted, exacerbated WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 4 with image from Liu et al., 2020
pharyngeal arch 5 dlx2a expression decreased amount, abnormal WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 7 with image from Liu et al., 2020
pharyngeal arch 3 dlx2a expression decreased amount, abnormal WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 7 with image from Liu et al., 2020
ceratobranchial 1 cartilage absent, exacerbated WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 4 cartilage absent, exacerbated WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 4 with image from Liu et al., 2020
ceratohyal cartilage straight, exacerbated WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 4 with image from Liu et al., 2020
ceratobranchial 3 cartilage absent, exacerbated WT + MO1-pax1a + MO3-pax1b standard conditions Fig. 4 with image from Liu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.