Morpholino

MO1-hnf1ba,hnf1bb

ID

ZDB-MRPHLNO-210202-1

Name

MO1-hnf1ba,hnf1bb

Previous Names

None

Targets

hnf1ba (1)
hnf1bb (1)

Sequence

5' - CTTGGACACCATGTTTGCAAACATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino targets both hnf1ba and hnf1bb though there are quite a few mismatches with hnf1bb.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hnf1ba,hnf1bb

Expressed Gene	Anatomy	Figures
cdh17	(not) pronephros	Fig. 2 from Sander et al., 2019

Phenotype

Phenotype resulting from MO1-hnf1ba,hnf1bb

No data available

Phenotype of all Fish created by or utilizing MO1-hnf1ba,hnf1bb

Phenotype	Fish	Conditions	Figures
pronephros cdh17 expression absent, abnormal	hnf1ba^{hi1843Tg/hi1843Tg} + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric proximal straight tubule slc2a2 expression decreased amount, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 4 from Sander et al., 2019
pronephric proximal straight tubule slc2a1a expression absent, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 4 from Sander et al., 2019
pronephric duct anterior region slc4a4a expression decreased amount, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric duct anterior region slc4a2a expression decreased amount, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric duct anterior region eps8l3b expression absent, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric duct anterior region lrp2a expression absent, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric proximal convoluted tubule slc2a1a expression absent, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 4 from Sander et al., 2019
pronephric duct anterior region pdzk1 expression absent, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric duct anterior region hnf4a expression absent, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric duct anterior region slc26a1 expression decreased amount, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric proximal convoluted tubule slc2a2 expression decreased amount, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 4 from Sander et al., 2019
pronephric duct anterior region slc20a1a expression absent, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephros cdh17 expression absent, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric duct slc5a9 expression decreased amount, abnormal	TU + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 4 from Sander et al., 2019
pronephric proximal straight tubule EGFP expression decreased amount, abnormal	nz4Tg + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019
pronephric proximal convoluted tubule EGFP expression decreased amount, abnormal	nz4Tg + MO1-hnf1ba + MO1-hnf1ba,hnf1bb	standard conditions	Fig. 2 from Sander et al., 2019

Citations