Morpholino

MO3-vgll4l

ID
ZDB-MRPHLNO-200323-1
Name
MO3-vgll4l
Previous Names
None
Target
Sequence
5' - TGTAGTGGAAATTAGTGACCGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-vgll4l
No data available
Phenotype
Phenotype resulting from MO3-vgll4l
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO3-vgll4l Figure 1 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group dnaaf4 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dhrs13a.1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cfap45 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group si:ch73-364h19.1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group ndr1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group quob expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cldn5a expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cftr expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group atp6ap1b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cdc14aa expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group vgll4l expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group sypl2b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group tnfrsf21 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.2 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group rassf7b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group odad4 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group slc35d1a expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group mbd3b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group abcc6a expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group rasgef1ba expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group nme5 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group tekt1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group daw1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO3-vgll4l Figure 10 from Fillatre et al., 2019
forerunner cell group nucleus ab1-5-mc labeling decreased amount, abnormal s870Tg + MO3-vgll4l Figure 10 from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO3-vgll4l Figure 1 with image,  Figure 9 from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO3-vgll4l Figure 1 with image,  Figure 9 from Fillatre et al., 2019
Phenotype of all Fish created by or utilizing MO3-vgll4l
Phenotype Fish Conditions Figures
forerunner cell group atp6ap1b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group cldn5a expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group rasgef1ba expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnaaf4 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group sypl2b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cftr expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group mbd3b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group daw1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group vgll4l expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group quob expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group rassf7b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group odad4 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cdc14aa expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group slc35d1a expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group abcc6a expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group dnmt3bb.2 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cfap45 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group si:ch73-364h19.1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group tekt1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group nme5 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group tnfrsf21 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group ndr1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dhrs13a.1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group decreased amount, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with image,  Figure 9 from Fillatre et al., 2019
Kupffer's vesicle decreased size, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group apoptotic process increased occurrence, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with image,  Figure 9 from Fillatre et al., 2019
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 3 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group cell population proliferation decreased occurrence, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO3-vgll4l standard conditions Figure 10 from Fillatre et al., 2019
forerunner cell group nucleus ab1-5-mc labeling decreased amount, abnormal s870Tg + MO3-vgll4l standard conditions Figure 10 from Fillatre et al., 2019
Citations