Morpholino
MO1-chst14
- ID
- ZDB-MRPHLNO-190828-1
- Name
- MO1-chst14
- Previous Names
- None
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - CATTAAAGATGTCTGTTTACTGAGG - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            The author was contacted and provided this corrected MO sequence.
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO1-chst14
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO1-chst14
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype of all Fish created by or utilizing MO1-chst14
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| locomotory behavior decreased efficacy, abnormal | WT + MO1-chst14 | transection: spinal cord | Fig. 1, 
                    
                        Fig. 5
                    
                    from Sahu et al., 2018 | 
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    