Morpholino
MO3-mir206-2
- ID
- ZDB-MRPHLNO-170907-2
- Name
- MO3-mir206-2
- Previous Names
- None
- Target
- Sequence
-
5' - GATCTCACTGAAGCCACACACTTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mir206-2
No data available
Phenotype
Phenotype resulting from MO3-mir206-2
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO3-mir206-2
1 - 5 of 23 Show all
Citations
- Lin, C.Y., Zhang, P.H., Chen, Y.J., Wu, C.L., Tsai, H.J. (2018) Conditional Overexpression of rtn4al in Muscle of Adult Zebrafish Displays Defects Similar to Human Amyotrophic Lateral Sclerosis. Marine biotechnology (New York, N.Y.). 21(1):52-64
- Lin, C.Y., He, J.Y., Zeng, C.W., Loo, M.R., Chang, W.Y., Zhang, P.H., Tsai, H.J. (2017) microRNA-206 modulates an Rtn4a/Cxcr4a/Thbs3a axis in newly forming somites to maintain and stabilize the somite boundary formation of zebrafish embryos.. Open Biology. 7(7)
- Lin, C.Y., Lee, H.C., Fu, C.Y., Ding, Y.Y., Chen, J.S., Lee, M.H., Huang, W.J., and Tsai, H.J. (2013) miR-1 and miR-206 target different genes to have opposing roles during angiogenesis in zebrafish embryos. Nature communications. 4:2829
1 - 3 of 3
Show