Morpholino

MO1-ptger3

ID
ZDB-MRPHLNO-170720-1
Name
MO1-ptger3
Previous Names
None
Target
Sequence
5' - AGCTGATAGGATACATACCAGTAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptger3
Expressed Gene Anatomy Figures
apln Figure 3 with image from Iwasaki et al., 2019
bmp2b Figure 3 with image from Iwasaki et al., 2019
ccbe1 Figure 3 with image from Iwasaki et al., 2019
dll4 Fig. 3,  Fig. 4,  Fig. 5 from Chen et al., 2017
flt4 Figure 3 with image from Iwasaki et al., 2019
lyve1b Figure 2 with image from Iwasaki et al., 2019
nr2f2 Figure 3 with image from Iwasaki et al., 2019
sox18 Figure 3 with image from Iwasaki et al., 2019
vegfc Figure 3 with image from Iwasaki et al., 2019
wnt5b Figure 3 with image from Iwasaki et al., 2019
Phenotype
Phenotype resulting from MO1-ptger3
Phenotype Fish Figures
dorsal longitudinal anastomotic vessel hypoplastic, abnormal y1Tg + MO1-ptger3 Fig. 1,  Fig. 3 from Chen et al., 2017
intersegmental vessel hypoplastic, abnormal y1Tg + MO1-ptger3 Fig. 1,  Fig. 3,  Fig. 5 from Chen et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO1-ptger3 Fig. 1 from Chen et al., 2017
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO1-ptger3 Fig. 1,  Fig. 3,  Fig. 5 from Chen et al., 2017
lymph vessel lyve1b expression decreased distribution, abnormal y1Tg + MO1-ptger3 Figure 2 with image from Iwasaki et al., 2019
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ptger3 Figure 1 with image from Iwasaki et al., 2019
posterior cardinal vein nr2f2 expression decreased amount, abnormal WT + MO1-ptger3 Figure 3 with image from Iwasaki et al., 2019
thoracic duct aplastic/hypoplastic, abnormal y1Tg + MO1-ptger3 Figure 1 with image from Iwasaki et al., 2019
trunk vasculature dll4 expression increased amount, abnormal WT + MO1-ptger3 Fig. 3,  Fig. 4,  Fig. 5 from Chen et al., 2017
vascular lymphangioblast aplastic/hypoplastic, abnormal y1Tg + MO1-ptger3 Figure 1 with image from Iwasaki et al., 2019
vascular lymphangioblast EGFP expression decreased distribution, abnormal y1Tg + MO1-ptger3 Figure 1 with image from Iwasaki et al., 2019
vascular lymphangioblast EGFP expression spatial pattern, abnormal y1Tg + MO1-ptger3 Figure 1 with image from Iwasaki et al., 2019
whole organism sox18 expression decreased amount, abnormal WT + MO1-ptger3 Figure 3 with image from Iwasaki et al., 2019
whole organism nr2f2 expression decreased amount, abnormal WT + MO1-ptger3 Figure 3 with image from Iwasaki et al., 2019
Phenotype of all Fish created by or utilizing MO1-ptger3
Phenotype Fish Conditions Figures
whole organism sox18 expression decreased amount, abnormal WT + MO1-ptger3 standard conditions Figure 3 with image from Iwasaki et al., 2019
whole organism nr2f2 expression decreased amount, abnormal WT + MO1-ptger3 standard conditions Figure 3 with image from Iwasaki et al., 2019
trunk vasculature dll4 expression increased amount, abnormal WT + MO1-ptger3 standard conditions Fig. 3,  Fig. 4,  Fig. 5 from Chen et al., 2017
posterior cardinal vein nr2f2 expression decreased amount, abnormal WT + MO1-ptger3 standard conditions Figure 3 with image from Iwasaki et al., 2019
trunk vasculature dll4 expression amount, ameliorated WT + MO1-ptger3 chemical treatment: EC 2.7.11.11 (cAMP-dependent protein kinase) inhibitor Fig. 5 from Chen et al., 2017
intersegmental vessel sprouting angiogenesis occurrence, ameliorated y1Tg + MO1-ptger3 chemical treatment: EC 2.7.11.11 (cAMP-dependent protein kinase) inhibitor Fig. 5 from Chen et al., 2017
vascular lymphangioblast EGFP expression decreased distribution, abnormal y1Tg + MO1-ptger3 standard conditions Figure 1 with image from Iwasaki et al., 2019
intersegmental vessel hypoplastic, abnormal y1Tg + MO1-ptger3 standard conditions Fig. 1,  Fig. 3,  Fig. 5 from Chen et al., 2017
vascular lymphangioblast EGFP expression spatial pattern, abnormal y1Tg + MO1-ptger3 standard conditions Figure 1 with image from Iwasaki et al., 2019
intersegmental vessel morphology, ameliorated y1Tg + MO1-ptger3 chemical treatment: EC 2.7.11.11 (cAMP-dependent protein kinase) inhibitor Fig. 5 from Chen et al., 2017
thoracic duct aplastic/hypoplastic, abnormal y1Tg + MO1-ptger3 standard conditions Figure 1 with image from Iwasaki et al., 2019
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ptger3 standard conditions Figure 1 with image from Iwasaki et al., 2019
vascular lymphangioblast aplastic/hypoplastic, abnormal y1Tg + MO1-ptger3 standard conditions Figure 1 with image from Iwasaki et al., 2019
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO1-ptger3 standard conditions Fig. 1,  Fig. 3,  Fig. 5 from Chen et al., 2017
dorsal longitudinal anastomotic vessel hypoplastic, abnormal y1Tg + MO1-ptger3 standard conditions Fig. 1,  Fig. 3 from Chen et al., 2017
lymph vessel lyve1b expression decreased distribution, abnormal y1Tg + MO1-ptger3 standard conditions Figure 2 with image from Iwasaki et al., 2019
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO1-ptger3 standard conditions Fig. 1 from Chen et al., 2017
trunk vasculature dll4 expression amount, ameliorated WT + MO1-ctnnb1 + MO1-ctnnb2 + MO1-ptger3 standard conditions Fig. 4 from Chen et al., 2017
dorsal longitudinal anastomotic vessel morphology, ameliorated y1Tg + MO1-dll4 + MO1-ptger3 standard conditions Fig. 3 from Chen et al., 2017
intersegmental vessel sprouting angiogenesis occurrence, ameliorated y1Tg + MO1-dll4 + MO1-ptger3 standard conditions Fig. 3 from Chen et al., 2017
intersegmental vessel morphology, ameliorated y1Tg + MO1-dll4 + MO1-ptger3 standard conditions Fig. 3 from Chen et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.