Morpholino

MO1-smchd1

ID

ZDB-MRPHLNO-170322-5

Name

MO1-smchd1

Previous Names

exon 3 splice donor e3i3 (1)

Target

smchd1 (1)

Sequence

5' - AGGTGTGATTTCAGACTTACGCAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-smchd1

Expressed Gene	Anatomy	Figures
foxn1	thymic epithelium	Fig. S5 from Xue et al., 2019
gata1a	caudal hematopoietic tissue	Fig. S5 from Xue et al., 2019
hbbe1.1	ventral wall of dorsal aorta	Fig. S5 from Xue et al., 2019
myb	caudal hematopoietic tissue ventral wall of dorsal aorta	Fig. S5 from Xue et al., 2019
rag1	thymus	Fig. S5 from Xue et al., 2019
spi1b	ventral wall of dorsal aorta	Fig. S5 from Xue et al., 2019
tal1	caudal hematopoietic tissue	Fig. S5 from Xue et al., 2019

Phenotype

Phenotype resulting from MO1-smchd1

Phenotype	Fish	Figures
caudal hematopoietic tissue tal1 expression decreased amount, abnormal	TU + MO1-smchd1	Fig. S5 from Xue et al., 2019
caudal hematopoietic tissue myb expression decreased amount, abnormal	TU + MO1-smchd1	Fig. S5 from Xue et al., 2019
caudal hematopoietic tissue GFP expression decreased amount, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	Fig. 3 from Xue et al., 2019
caudal hematopoietic tissue gata1a expression decreased amount, abnormal	TU + MO1-smchd1	Fig. S5 from Xue et al., 2019
caudal hematopoietic tissue GFP expression decreased distribution, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	Fig. 3 from Xue et al., 2019
caudal hematopoietic tissue hematopoietic cell decreased amount, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	Fig. 3 from Xue et al., 2019
ceratohyal cartilage malformed, abnormal	zf195Tg + MO1-smchd1 (AB)	Fig. 5 from Shaw et al., 2017
embryonic cranial skeleton morphogenesis decreased process quality, abnormal	zf195Tg + MO1-smchd1 (AB)	Fig. 5 from Shaw et al., 2017
embryonic viscerocranium morphogenesis decreased process quality, abnormal	zf195Tg + MO1-smchd1 (AB)	Fig. 5 from Shaw et al., 2017
ethmoid cartilage decreased width, abnormal	zf195Tg + MO1-smchd1 (AB)	Fig. 5 from Shaw et al., 2017
eye decreased size, abnormal	zf195Tg + MO1-smchd1 (AB)	Fig. 5 from Shaw et al., 2017
hematopoietic multipotent progenitor cell cell population proliferation decreased occurrence, abnormal	cz3331Tg + MO1-smchd1	Fig. S5 from Xue et al., 2019
pharyngeal arch 3-7 skeleton has fewer parts of type ceratobranchial cartilage, abnormal	zf195Tg + MO1-smchd1 (AB)	Fig. 5 from Shaw et al., 2017
thymus GFP expression decreased amount, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	Fig. 3 from Xue et al., 2019
thymus rag1 expression decreased amount, abnormal	TU + MO1-smchd1	Fig. S5 from Xue et al., 2019
thymus GFP expression decreased distribution, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	Fig. 3 from Xue et al., 2019
thymus hematopoietic cell decreased amount, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	Fig. 3 from Xue et al., 2019

Phenotype of all Fish created by or utilizing MO1-smchd1

Phenotype	Fish	Conditions	Figures
caudal hematopoietic tissue tal1 expression decreased amount, abnormal	TU + MO1-smchd1	control	Fig. S5 from Xue et al., 2019
caudal hematopoietic tissue gata1a expression decreased amount, abnormal	TU + MO1-smchd1	control	Fig. S5 from Xue et al., 2019
thymus rag1 expression decreased amount, abnormal	TU + MO1-smchd1	control	Fig. S5 from Xue et al., 2019
caudal hematopoietic tissue myb expression decreased amount, abnormal	TU + MO1-smchd1	control	Fig. S5 from Xue et al., 2019
hematopoietic multipotent progenitor cell cell population proliferation decreased occurrence, abnormal	cz3331Tg + MO1-smchd1	control	Fig. S5 from Xue et al., 2019
eye decreased size, abnormal	zf195Tg + MO1-smchd1 (AB)	standard conditions	Fig. 5 from Shaw et al., 2017
embryonic cranial skeleton morphogenesis decreased process quality, abnormal	zf195Tg + MO1-smchd1 (AB)	standard conditions	Fig. 5 from Shaw et al., 2017
embryonic viscerocranium morphogenesis decreased process quality, abnormal	zf195Tg + MO1-smchd1 (AB)	standard conditions	Fig. 5 from Shaw et al., 2017
ceratohyal cartilage malformed, abnormal	zf195Tg + MO1-smchd1 (AB)	standard conditions	Fig. 5 from Shaw et al., 2017
ethmoid cartilage decreased width, abnormal	zf195Tg + MO1-smchd1 (AB)	standard conditions	Fig. 5 from Shaw et al., 2017
pharyngeal arch 3-7 skeleton has fewer parts of type ceratobranchial cartilage, abnormal	zf195Tg + MO1-smchd1 (AB)	standard conditions	Fig. 5 from Shaw et al., 2017
caudal hematopoietic tissue hematopoietic cell decreased amount, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	control	Fig. 3 from Xue et al., 2019
thymus GFP expression decreased distribution, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	control	Fig. 3 from Xue et al., 2019
caudal hematopoietic tissue GFP expression decreased distribution, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	control	Fig. 3 from Xue et al., 2019
caudal hematopoietic tissue GFP expression decreased amount, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	control	Fig. 3 from Xue et al., 2019
thymus GFP expression decreased amount, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	control	Fig. 3 from Xue et al., 2019
thymus hematopoietic cell decreased amount, abnormal	ioz1Tg; pku6Tg + MO1-smchd1	control	Fig. 3 from Xue et al., 2019

Citations