Morpholino

MO2-exosc8

ID
ZDB-MRPHLNO-140929-2
Name
MO2-exosc8
Previous Names
None
Target
Sequence
5' - TTTAAAACCAGCCGCCATGATGTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-exosc8
Expressed Gene Anatomy Figures
atxn1a Fig. 6 from Giunta et al., 2016
atxn1b Fig. 6 from Giunta et al., 2016
Phenotype
Phenotype resulting from MO2-exosc8
Phenotype Fish Figures
axonogenesis disrupted, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
brain development disrupted, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
cerebellar Purkinje cell layer structural organization disrupted, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
cerebellum structure, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
cerebellum Purkinje cell distributed, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
eye decreased size, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
eye shape, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO2-exosc8 Fig. 4 with image from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal rw0Tg + MO2-exosc8 Fig. 4 with image from Giunta et al., 2016
motor neuron axon branchiness, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
motor neuron axon truncated, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
pericardium edematous, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
post-vent region decreased length, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
sensory perception of touch disrupted, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
swimming disrupted, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
whole organism malformed, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
Phenotype of all Fish created by or utilizing MO2-exosc8
Phenotype Fish Conditions Figures
post-vent region decreased length, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
cerebellar Purkinje cell layer structural organization disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
motor neuron axon truncated, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
eye shape, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
whole organism malformed, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
sensory perception of touch disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
cerebellum Purkinje cell distributed, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
motor neuron axon branchiness, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
brain development disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
cerebellum structure, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
pericardium edematous, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
axonogenesis disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 4 with image from Giunta et al., 2016
swimming disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
eye decreased size, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 4 with image from Giunta et al., 2016
whole organism atxn1b expression increased amount, abnormal slc24a5unspecified/unspecified + MO2-exosc8 standard conditions Fig. 6 from Giunta et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.