Morpholino

MO1-marcksb

ID
ZDB-MRPHLNO-130809-8
Name
MO1-marcksb
Previous Names
  • MAT (1)
Target
Sequence
5' - TTTTGGAGATTTGTGCTCCCATGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-marcksb
No data available
Phenotype
Phenotype resulting from MO1-marcksb
Phenotype Fish Figures
BMP signaling pathway decreased occurrence, abnormal AB + MO1-marcksb Fig 2 with image from Ye et al., 2019
brain morphology, abnormal WT + MO1-marcksb Fig. 3,  Fig. 5,  Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksb + MO4-tp53 Fig. 3,  Fig. 5,  Fig. 6 from Ott et al., 2011
cell lacks parts or has fewer parts of type cell filopodium, abnormal WT + MO1-marcksb Fig. 6 with image from Wang et al., 2013
cell filamentous actin disorganized, abnormal WT + MO1-marcksb Fig. 6 with image from Wang et al., 2013
convergent extension involved in gastrulation process quality, abnormal WT + MO1-marcksb Fig. 6 with image from Wang et al., 2013
epiboly involved in gastrulation with mouth forming second process quality, abnormal AB + MO1-marcksb Fig 5 with image from Ye et al., 2019
eye morphology, abnormal WT + MO1-marcksb Fig. 3,  Fig. 5,  Fig. 6 from Ott et al., 2011
gastrulation process quality, abnormal WT + MO1-marcksb Fig. 6 with image from Wang et al., 2013
margin ventral region eve1 expression decreased distribution, abnormal AB + MO1-marcksb Fig 1 with image from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal AB + MO1-marcksb Fig 8 with image from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal AB + MO1-marcksb Fig 1 with image,  Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal AB + MO1-marcksb Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-marcksb Fig 1 with image,  Fig 8 with image from Ye et al., 2019
post-vent region curved, abnormal WT + MO1-marcksb + MO4-tp53 Fig. 6 from Ott et al., 2011
post-vent region decreased length, abnormal WT + MO1-marcksb Fig. 3,  Fig. 5 from Ott et al., 2011
shield chrd expression increased distribution, abnormal AB + MO1-marcksb Fig 1 with image from Ye et al., 2019
whole organism curved, abnormal WT + MO1-marcksb Fig. 3,  Fig. 5 from Ott et al., 2011
whole organism dead, abnormal WT + MO1-marcksb Fig. 5 from Ott et al., 2011
whole organism marcksb expression decreased amount, abnormal AB + MO1-marcksb Fig 7 with image from Ye et al., 2019
whole organism hsp70.3 expression decreased amount, abnormal AB + MO1-marcksb Fig 7 with image from Ye et al., 2019
whole organism dorsalized, abnormal AB + MO1-marcksb Fig 1 with image from Ye et al., 2019
whole organism spindle-shaped, abnormal AB + MO1-marcksb Fig 1 with image from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal AB + MO1-marcksb Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal AB + MO1-marcksb Fig 8 with image from Ye et al., 2019
whole organism ventral region Ab13-smad labeling decreased amount, abnormal AB + MO1-marcksb Fig 2 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal AB + MO1-marcksb Fig 2 with image,  Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal AB + MO1-marcksb Fig 2 with image,  Fig 8 with image from Ye et al., 2019
whole organism ventral region szl expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksb Fig 6 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksb Fig 6 with image from Ye et al., 2019
Phenotype of all Fish created by or utilizing MO1-marcksb
Phenotype Fish Conditions Figures
whole organism ventral region szl expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksb standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksb standard conditions Fig 6 with image from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal AB + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal AB + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
margin ventral region eve1 expression decreased distribution, abnormal AB + MO1-marcksb standard conditions Fig 1 with image from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal AB + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
BMP signaling pathway decreased occurrence, abnormal AB + MO1-marcksb standard conditions Fig 2 with image from Ye et al., 2019
whole organism hsp70.3 expression decreased amount, abnormal AB + MO1-marcksb standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal AB + MO1-marcksb standard conditions Fig 2 with image,  Fig 8 with image from Ye et al., 2019
whole organism dorsalized, abnormal AB + MO1-marcksb standard conditions Fig 1 with image from Ye et al., 2019
whole organism ventral region Ab13-smad labeling decreased amount, abnormal AB + MO1-marcksb standard conditions Fig 2 with image from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal AB + MO1-marcksb standard conditions Fig 1 with image,  Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal AB + MO1-marcksb standard conditions Fig 2 with image,  Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-marcksb standard conditions Fig 1 with image,  Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal AB + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism marcksb expression decreased amount, abnormal AB + MO1-marcksb standard conditions Fig 7 with image from Ye et al., 2019
shield chrd expression increased distribution, abnormal AB + MO1-marcksb standard conditions Fig 1 with image from Ye et al., 2019
whole organism spindle-shaped, abnormal AB + MO1-marcksb standard conditions Fig 1 with image from Ye et al., 2019
epiboly involved in gastrulation with mouth forming second process quality, abnormal AB + MO1-marcksb standard conditions Fig 5 with image from Ye et al., 2019
post-vent region curved, abnormal WT + MO1-marcksb standard conditions Fig. 6 from Ott et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-marcksb standard conditions Fig. 6 with image from Wang et al., 2013
brain morphology, abnormal WT + MO1-marcksb standard conditions Fig. 3,  Fig. 5,  Fig. 6 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksb standard conditions Fig. 3,  Fig. 5,  Fig. 6 from Ott et al., 2011
cell lacks parts or has fewer parts of type cell filopodium, abnormal WT + MO1-marcksb standard conditions Fig. 6 with image from Wang et al., 2013
cell filamentous actin disorganized, abnormal WT + MO1-marcksb standard conditions Fig. 6 with image from Wang et al., 2013
post-vent region decreased length, abnormal WT + MO1-marcksb standard conditions Fig. 3,  Fig. 5 from Ott et al., 2011
whole organism curved, abnormal WT + MO1-marcksb standard conditions Fig. 3,  Fig. 5 from Ott et al., 2011
gastrulation process quality, abnormal WT + MO1-marcksb standard conditions Fig. 6 with image from Wang et al., 2013
brain development disrupted, abnormal WT + MO1-marcksb standard conditions Fig. 3,  Fig. 5,  Fig. 6 from Ott et al., 2011
whole organism dead, abnormal WT + MO1-marcksb standard conditions Fig. 5 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
whole organism ventral region ved expression decreased amount, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism spindle-shaped, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
Citations