Morpholino
MO1-agrp
- ID
- ZDB-MRPHLNO-130226-1
- Name
- MO1-agrp
- Previous Names
-
- agrp ATG MO (1)
- Target
- Sequence
-
5' - ACTGTGTTCAGCATCATAATCACTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-agrp
No data available
Phenotype
Phenotype resulting from MO1-agrp
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-agrp
1 - 5 of 9 Show all
Citations
- Renquist, B.J., Zhang, C., Williams, S.Y., and Cone, R.D. (2013) Development of an Assay for High-Throughput Energy Expenditure Monitoring in the Zebrafish. Zebrafish. 10(3):343-52
- Sebag, J.A., Zhang, C., Hinkle, P.M., Bradshaw, A.M., and Cone, R.D. (2013) Developmental control of the melanocortin-4 receptor by MRAP2 proteins in zebrafish. Science (New York, N.Y.). 341(6143):278-281
- Zhang, C., Forlano, P.M., and Cone, R.D. (2012) AgRP and POMC neurons are hypophysiotropic and coordinately regulate multiple endocrine axes in a larval teleost. Cell Metabolism. 15(2):256-264
- Zhang, C., Song, Y., Thompson, D.A., Madonna, M.A., Millhauser, G.L., Toro, S., Varga, Z., Westerfield, M., Gamse, J., Chen, W., Cone, R.D. (2010) Pineal-specific agouti protein regulates teleost background adaptation. Proceedings of the National Academy of Sciences of the United States of America. 107(47):20164-71
1 - 4 of 4
Show