Morpholino
MO4-cxcl8a
- ID
- ZDB-MRPHLNO-130219-5
- Name
- MO4-cxcl8a
- Previous Names
-
- splice-blocking morpholino (1)
- Target
- Sequence
-
5' - TATTTATGCTTACTTGACAATGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-cxcl8a
No data available
Phenotype
Phenotype resulting from MO4-cxcl8a
No data available
Phenotype of all Fish created by or utilizing MO4-cxcl8a
1 - 5 of 10 Show all
Citations
- Bernut, A., Loynes, C.A., Floto, R.A., Renshaw, S.A. (2020) Deletion of cftr Leads to an Excessive Neutrophilic Response and Defective Tissue Repair in a Zebrafish Model of Sterile Inflammation. Frontiers in immunology. 11:1733
- Coombs, C., Georgantzoglou, A., Walker, H.A., Patt, J., Merten, N., Poplimont, H., Busch-Nentwich, E.M., Williams, S., Kotsi, C., Kostenis, E., Sarris, M. (2019) Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish. Nature communications. 10:5166
- Bernut, A., Nguyen-Chi, M., Halloum, I., Herrmann, J.L., Lutfalla, G., Kremer, L. (2016) Mycobacterium abscessus-Induced Granuloma Formation Is Strictly Dependent on TNF Signaling and Neutrophil Trafficking. PLoS pathogens. 12:e1005986
- Sarris, M., Masson, J.B., Maurin, D., Van der Aa, L.M., Boudinot, P., Lortat-Jacob, H., and Herbomel, P. (2012) Inflammatory Chemokines Direct and Restrict Leukocyte Migration within Live Tissues as Glycan-Bound Gradients. Current biology : CB. 22(24):2375-2382
1 - 4 of 4
Show