Morpholino

MO1-kif22

ID

ZDB-MRPHLNO-121210-5

Name

MO1-kif22

Previous Names

None

Target

kif22 (1)

Sequence

5' - CTTTCCTGAGGTGAAGAACAAGAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-kif22

No data available

Phenotype

Phenotype resulting from MO1-kif22

Phenotype	Fish	Figures
brain morphology, abnormal	WT + MO1-kif22	Fig. 2 from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal	WT + MO1-kif22	Fig. 3 from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal	WT + MO1-kif22	Fig. 5 from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal	WT + MO1-kif22	Fig. 5 from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal	WT + MO1-kif22	Fig. 5 from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal	WT + MO1-kif22	Fig. 5 from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal	WT + MO1-kif22	Fig. 3 from Blaker-Lee et al., 2012
post-vent region shape, abnormal	WT + MO1-kif22	Fig. 3 from Blaker-Lee et al., 2012
somite U-shaped, abnormal	WT + MO1-kif22	Fig. 3 , Fig. 6 from Blaker-Lee et al., 2012
somite contractile muscle fiber disorganized, abnormal	WT + MO1-kif22	Fig. 6 from Blaker-Lee et al., 2012
somite contractile muscle fiber undulate, abnormal	WT + MO1-kif22	Fig. 6 from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal	WT + MO1-kif22	Fig. 3 from Blaker-Lee et al., 2012

Phenotype of all Fish created by or utilizing MO1-kif22

Phenotype	Fish	Conditions	Figures
hindbrain axon decreased length, abnormal	WT + MO1-kif22	standard conditions	Fig. 5 from Blaker-Lee et al., 2012
post-vent region shape, abnormal	WT + MO1-kif22	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
somite contractile muscle fiber disorganized, abnormal	WT + MO1-kif22	standard conditions	Fig. 6 from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal	WT + MO1-kif22	standard conditions	Fig. 5 from Blaker-Lee et al., 2012
brain morphology, abnormal	WT + MO1-kif22	standard conditions	Fig. 2 from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal	WT + MO1-kif22	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal	WT + MO1-kif22	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal	WT + MO1-kif22	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
somite contractile muscle fiber undulate, abnormal	WT + MO1-kif22	standard conditions	Fig. 6 from Blaker-Lee et al., 2012
somite U-shaped, abnormal	WT + MO1-kif22	standard conditions	Fig. 3 , Fig. 6 from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal	WT + MO1-kif22	standard conditions	Fig. 5 from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal	WT + MO1-kif22	standard conditions	Fig. 5 from Blaker-Lee et al., 2012
ventricular system morphology, abnormal	AB + MO1-doc2a + MO1-kif22 + MO4-tp53	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO1-doc2a + MO1-kif22 + MO4-tp53	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal	AB + MO1-hirip3 + MO1-kif22 + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO1-hirip3 + MO1-kif22 + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal	AB + MO1-hirip3 + MO1-kif22 + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal	AB + MO1-ino80e + MO1-kif22 + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO1-ino80e + MO1-kif22 + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S3 , Table S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S3 , Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal	nl1Tg + MO1-hirip3 + MO1-kif22 + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal	nl1Tg + MO1-ino80e + MO1-kif22 + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal	nl1Tg + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal	rw0Tg + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017

Citations