Morpholino

MO1-f2r

ID
ZDB-MRPHLNO-120604-3
Name
MO1-f2r
Previous Names
None
Target
Sequence
5' - CCGTCACCAACAGAACCCGCAACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-f2r
No data available
Phenotype
Phenotype resulting from MO1-f2r
Phenotype Fish Figures
blood increased accumulation caudal vein, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
blood increased accumulation vasculature, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
blood increased accumulation blood island, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
blood increased accumulation post-vent region, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
blood circulation disrupted, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
caudal vein dilated, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with imageFig. 4 with image from Ellertsdottir et al., 2012
caudal vein disorganized, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 4 with image from Ellertsdottir et al., 2012
caudal vein functionality, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
caudal vein malformed, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
central artery hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r text only from Ellertsdottir et al., 2012
circulatory system development disrupted, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
dorsal aorta decreased size, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 4 with imagetext only from Ellertsdottir et al., 2012
endothelial to hematopoietic transition increased occurrence, abnormal WT + MO1-f2r Fig. 4 with image from Yue et al., 2012
heart edematous, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
heart contraction decreased rate, abnormal AB + MO1-f2r Fig. 1 with imageFig. 2 with image from Ellertsdottir et al., 2012
hematopoietic stem cell differentiation increased occurrence, abnormal WT + MO1-f2r Fig. 4 with image from Yue et al., 2012
intersegmental vessel collapsed, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 4 with image from Ellertsdottir et al., 2012
midbrain hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
mouth structure, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
optic choroid vascular plexus hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r text only from Ellertsdottir et al., 2012
post-vent region bent, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
posterior cardinal vein functionality, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
swim bladder physical object quality, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal WT + MO1-f2r Fig. 4 with image from Yue et al., 2012
Phenotype of all Fish created by or utilizing MO1-f2r
Phenotype Fish Conditions Figures
mouth structure, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
caudal vein functionality, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
heart edematous, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
blood circulation disrupted, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
circulatory system development disrupted, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
blood increased accumulation vasculature, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
posterior cardinal vein functionality, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
blood increased accumulation post-vent region, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
post-vent region bent, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
blood increased accumulation blood island, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
heart contraction decreased rate, abnormal AB + MO1-f2r standard conditions Fig. 1 with imageFig. 2 with image from Ellertsdottir et al., 2012
swim bladder physical object quality, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal WT + MO1-f2r standard conditions Fig. 4 with image from Yue et al., 2012
hematopoietic stem cell differentiation increased occurrence, abnormal WT + MO1-f2r standard conditions Fig. 4 with image from Yue et al., 2012
endothelial to hematopoietic transition increased occurrence, abnormal WT + MO1-f2r standard conditions Fig. 4 with image from Yue et al., 2012
optic choroid vascular plexus hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions text only from Ellertsdottir et al., 2012
blood increased accumulation caudal vein, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
caudal vein malformed, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
blood increased accumulation blood island, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
caudal vein disorganized, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
central artery hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions text only from Ellertsdottir et al., 2012
intersegmental vessel collapsed, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
dorsal aorta decreased size, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 4 with imagetext only from Ellertsdottir et al., 2012
midbrain hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
caudal vein dilated, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with imageFig. 4 with image from Ellertsdottir et al., 2012
Citations