Morpholino
MO1-fmnl3
- ID
- ZDB-MRPHLNO-120503-2
- Name
- MO1-fmnl3
- Previous Names
- None
- Target
- Sequence
-
5' - CGTCCACACTCTCAATATTCCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fmnl3
No data available
Phenotype
Phenotype resulting from MO1-fmnl3
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-fmnl3
1 - 5 of 14 Show all
Citations
- Phng, L.K., Gebala, V., Bentley, K., Philippides, A., Wacker, A., Mathivet, T., Sauteur, L., Stanchi, F., Belting, H.G., Affolter, M., Gerhardt, H. (2015) Formin-mediated actin polymerization at endothelial junctions is required for vessel lumen formation and stabilization. Developmental Cell. 32:123-32
- Wakayama, Y., Fukuhara, S., Ando, K., Matsuda, M., Mochizuki, N. (2015) Cdc42 Mediates Bmp-Induced Sprouting Angiogenesis through Fmnl3-Driven Assembly of Endothelial Filopodia in Zebrafish. Developmental Cell. 32:109-22
- Hetheridge, C., Scott, A.N., Swain, R.K., Copeland, J.W., Higgs, H.N., Bicknell, R., and Mellor, H. (2012) The formin FMNL3 is a cytoskeletal regulator of angiogenesis. Journal of Cell Science. 125:1420-1428
1 - 3 of 3
Show