Morpholino
MO1-vcana
- ID
- ZDB-MRPHLNO-120404-6
- Name
- MO1-vcana
- Previous Names
-
- versican-MO (1)
- Target
- Sequence
-
5' - CTGAAACACCCATGGGAGTGGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vcana
No data available
Phenotype
Phenotype resulting from MO1-vcana
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-vcana
1 - 5 of 12 Show all
Citations
- Mori, Y., Smith, S., Wang, J., Eliora, N., Heikes, K.L., Munjal, A. (2024) Versican controlled by Lmx1b regulates hyaluronate density and hydration for semicircular canal morphogenesis. Development (Cambridge, England). 152(1):
- Müller-Deile, J., Gellrich, F., Schenk, H., Schroder, P., Nyström, J., Lorenzen, J., Haller, H., Schiffer, M. (2016) Overexpression of TGF-β Inducible microRNA-143 in Zebrafish Leads to Impairment of the Glomerular Filtration Barrier by Targeting Proteoglycans. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology. 40:819-830
- Lee, H.C., Lo, H.C., Lo, D.M., Su, M.Y., Hu, J.R., Wu, C.C., Chang, S.N., Dai, M.S., Tsai, C.T., Tsai, H.J. (2015) Amiodarone Induces Overexpression of Similar to Versican b to Repress the EGFR/Gsk3b/Snail Signaling Axis during Cardiac Valve Formation of Zebrafish Embryos. PLoS One. 10:e0144751
- Chen, Y.H., Hsu, R.J., Chen, T.Y., Huang, Y.K., Lee, H.C., Hu, S.C., Harn, H.J., Jeng, J.R., Sun, C.K., Lin, S.Z., and Tsai, H.J. (2012) The toxic effect of Amiodarone on valve formation in the developing heart of zebrafish embryos. Reproductive toxicology (Elmsford, N.Y.). 33(2):233-244
1 - 4 of 4
Show