Morpholino
MO3-bmpr2b
- ID
- ZDB-MRPHLNO-110729-3
- Name
- MO3-bmpr2b
- Previous Names
-
- bmpr2b #1 (1)
- Target
- Sequence
-
5' - AGTTGATTCTGACCTTGTTTGACCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bmpr2b
No data available
Phenotype
Phenotype resulting from MO3-bmpr2b
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO3-bmpr2b
1 - 5 of 12 Show all
Citations
- Neal, A., Nornes, S., Payne, S., Wallace, M.D., Fritzsche, M., Louphrasitthiphol, P., Wilkinson, R.N., Chouliaras, K.M., Liu, K., Plant, K., Sholapurkar, R., Ratnayaka, I., Herzog, W., Bond, G., Chico, T., Bou-Gharios, G., De Val, S. (2019) Venous identity requires BMP signalling through ALK3. Nature communications. 10:453
- Wakayama, Y., Fukuhara, S., Ando, K., Matsuda, M., Mochizuki, N. (2015) Cdc42 Mediates Bmp-Induced Sprouting Angiogenesis through Fmnl3-Driven Assembly of Endothelial Filopodia in Zebrafish. Developmental Cell. 32:109-22
- Kim, J.D., Kim, J. (2014) Alk3/Alk3b and Smad5 Mediate BMP Signaling during Lymphatic Development in Zebrafish. Molecules and cells. 37:270-4
- Wiley, D.M., Kim, J.D., Hao, J., Hong, C.C., Bautch, V.L., and Jin, S.W. (2011) Distinct signalling pathways regulate sprouting angiogenesis from the dorsal aorta and the axial vein. Nature cell biology. 13(6):686-92
1 - 4 of 4
Show