Morpholino
MO3-bmpr2a
- ID
- ZDB-MRPHLNO-110729-1
- Name
- MO3-bmpr2a
- Previous Names
-
- bmpr2a #1 (1)
- Target
- Sequence
-
5' - AGAGAAACGTATTTGCATACCTTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bmpr2a
No data available
Phenotype
Phenotype resulting from MO3-bmpr2a
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO3-bmpr2a
1 - 5 of 15 Show all
Citations
- Neal, A., Nornes, S., Payne, S., Wallace, M.D., Fritzsche, M., Louphrasitthiphol, P., Wilkinson, R.N., Chouliaras, K.M., Liu, K., Plant, K., Sholapurkar, R., Ratnayaka, I., Herzog, W., Bond, G., Chico, T., Bou-Gharios, G., De Val, S. (2019) Venous identity requires BMP signalling through ALK3. Nature communications. 10:453
- Wakayama, Y., Fukuhara, S., Ando, K., Matsuda, M., Mochizuki, N. (2015) Cdc42 Mediates Bmp-Induced Sprouting Angiogenesis through Fmnl3-Driven Assembly of Endothelial Filopodia in Zebrafish. Developmental Cell. 32:109-22
- Kim, J.D., Kang, H., Larrivée, B., Lee, M.Y., Mettlen, M., Schmid, S.L., Roman, B.L., Qyang, Y., Eichmann, A., and Jin, S.W. (2012) Context-dependent proangiogenic function of bone morphogenetic protein signaling is mediated by disabled homolog 2. Developmental Cell. 23(2):441-448
- Wiley, D.M., Kim, J.D., Hao, J., Hong, C.C., Bautch, V.L., and Jin, S.W. (2011) Distinct signalling pathways regulate sprouting angiogenesis from the dorsal aorta and the axial vein. Nature cell biology. 13(6):686-92
1 - 4 of 4
Show