Morpholino

MO2-ctbp2l

ID

ZDB-MRPHLNO-110325-2

Name

MO2-ctbp2l

Previous Names

None

Target

ctbp2l (1)

Sequence

5' - CAGTTGCATCATTACTTGTTTCCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Slice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ctbp2l

Expressed Gene	Anatomy	Figures
cacna1da	(not) anterior lateral line neuromast neuromast hair cell (not) neuromast hair cell presynaptic active zone whole organism	Fig. 2 , Fig. 8 from Sheets et al., 2011
ctbp2a	neuromast hair cell whole organism	Fig. 2 , Fig. 3 , Fig. 5 , Fig. 7 from Sheets et al., 2011
ctbp2l	(not) anterior lateral line neuromast neuromast hair cell (not) neuromast hair cell (not) whole organism	Fig. 2 , Fig. 3 , Fig. 5 , Fig. 8 from Sheets et al., 2011

Phenotype

Phenotype resulting from MO2-ctbp2l

Phenotype	Fish	Figures
angular vestibuloocular reflex decreased process quality, abnormal	WT + MO2-ctbp2l	Fig. 4 from Sheets et al., 2011
clustering of voltage-gated calcium channels decreased process quality, abnormal	WT + MO2-ctbp2l	Fig. 8 from Sheets et al., 2011
detection of mechanical stimulus involved in sensory perception of sound decreased process quality, abnormal	nl1Tg + MO2-ctbp2l	Fig. 5 from Sheets et al., 2011
neuromast hair cell cytoskeleton of presynaptic active zone decreased amount, abnormal	nl1Tg + MO2-ctbp2l	Fig. 5 from Sheets et al., 2011
neuromast hair cell cytoskeleton of presynaptic active zone decreased size, abnormal	WT + MO2-ctbp2l	Fig. s2 from Sheets et al., 2011
neuromast hair cell voltage-gated calcium channel complex decreased distribution, abnormal	WT + MO2-ctbp2l	Fig. 8 from Sheets et al., 2011
presynaptic membrane assembly decreased process quality, abnormal	WT + MO2-ctbp2l	Fig. 8 from Sheets et al., 2011
response to auditory stimulus decreased process quality, abnormal	WT + MO2-ctbp2l	Fig. 4 from Sheets et al., 2011

Phenotype of all Fish created by or utilizing MO2-ctbp2l

Phenotype	Fish	Conditions	Figures
presynaptic membrane assembly decreased process quality, abnormal	WT + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
response to auditory stimulus decreased process quality, abnormal	WT + MO2-ctbp2l	standard conditions	Fig. 4 from Sheets et al., 2011
neuromast hair cell voltage-gated calcium channel complex decreased distribution, abnormal	WT + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
angular vestibuloocular reflex decreased process quality, abnormal	WT + MO2-ctbp2l	standard conditions	Fig. 4 from Sheets et al., 2011
clustering of voltage-gated calcium channels decreased process quality, abnormal	WT + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
neuromast hair cell cytoskeleton of presynaptic active zone decreased size, abnormal	WT + MO2-ctbp2l	standard conditions	Fig. s2 from Sheets et al., 2011
neuromast hair cell cytoskeleton of presynaptic active zone decreased amount, abnormal	nl1Tg + MO2-ctbp2l	standard conditions	Fig. 5 from Sheets et al., 2011
detection of mechanical stimulus involved in sensory perception of sound decreased process quality, abnormal	nl1Tg + MO2-ctbp2l	standard conditions	Fig. 5 from Sheets et al., 2011
posterior lateral line nerve postsynaptic density separated from neuromast hair cell cytoskeleton of presynaptic active zone, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 7 from Sheets et al., 2011
presynaptic membrane assembly decreased process quality, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
neuromast hair cell voltage-gated calcium channel complex decreased distribution, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
response to auditory stimulus decreased process quality, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 4 from Sheets et al., 2011
postsynaptic density assembly decreased process quality, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 7 from Sheets et al., 2011
clustering of voltage-gated calcium channels decreased process quality, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
axonogenesis involved in innervation decreased process quality, abnormal	nl1Tg + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 6 from Sheets et al., 2011
neuromast hair cell cytoskeleton of presynaptic active zone decreased amount, abnormal	nl1Tg + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 6 from Sheets et al., 2011
posterior lateral line nerve dendrite decreased length, abnormal	nl1Tg + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 6 from Sheets et al., 2011
posterior lateral line nerve dendrite unbranched, abnormal	nl1Tg + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 6 from Sheets et al., 2011

Citations