Morpholino
MO5-foxj1a
- ID
- ZDB-MRPHLNO-101117-1
- Name
- MO5-foxj1a
- Previous Names
- None
- Target
- Sequence
-
5' - ACCAATGTGAAAATGTGTTACCTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-foxj1a
No data available
Phenotype
Phenotype resulting from MO5-foxj1a
No data available
Phenotype of all Fish created by or utilizing MO5-foxj1a
1 - 5 of 5
Citations
- Austin-Tse, C., Halbritter, J., Zariwala, M.A., Gilberti, R.M., Gee, H.Y., Hellman, N., Pathak, N., Liu, Y., Panizzi, J.R., Patel-King, R.S., Tritschler, D., Bower, R., O'Toole, E., Porath, J.D., Hurd, T.W., Chaki, M., Diaz, K.A., Kohl, S., Lovric, S., Hwang, D.Y., Braun, D.A., Schueler, M., Airik, R., Otto, E.A., Leigh, M.W., Noone, P.G., Carson, J.L., Davis, S.D., Pittman, J.E., Ferkol, T.W., Atkinson, J.J., Olivier, K.N., Sagel, S.D., Dell, S.D., Rosenfeld, M., Milla, C.E., Loges, N.T., Omran, H., Porter, M.E., King, S.M., Knowles, M.R., Drummond, I.A., and Hildebrandt, F. (2013) Zebrafish Ciliopathy Screen Plus Human Mutational Analysis Identifies C21orf59 and CCDC65 Defects as Causing Primary Ciliary Dyskinesia. American journal of human genetics. 93(4):672-686
- Panizzi, J.R., Becker-Heck, A., Castleman, V.H., Al-Mutairi, D.A., Liu, Y., Loges, N.T., Pathak, N., Austin-Tse, C., Sheridan, E., Schmidts, M., Olbrich, H., Werner, C., Häffner, K., Hellman, N., Chodhari, R., Gupta, A., Kramer-Zucker, A., Olale, F., Burdine, R.D., Schier, A.F., O'Callaghan, C., Chung, E.M., Reinhardt, R., Mitchison, H.M., King, S.M., Omran, H., and Drummond, I.A. (2012) CCDC103 mutations cause primary ciliary dyskinesia by disrupting assembly of ciliary dynein arms. Nature Genetics. 44(6):714-719
- Hellman, N.E., Liu, Y., Merkel, E., Austin, C., Le Corre, S., Beier, D.R., Sun, Z., Sharma, N., Yoder, B.K., and Drummond, I.A. (2010) The zebrafish foxj1a transcription factor regulates cilia function in response to injury and epithelial stretch. Proceedings of the National Academy of Sciences of the United States of America. 107(43):18499-18504
1 - 3 of 3
Show