Morpholino

MO2-plk1

ID
ZDB-MRPHLNO-100908-2
Name
MO2-plk1
Previous Names
  • plk1 ATG mO (1)
Target
Sequence
5' - AATTGCAGCACTCATCGTTGTACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-plk1
Expressed Gene Anatomy Figures
plk1 Fig. 1 with image from Jeong et al., 2010
Phenotype
Phenotype resulting from MO2-plk1
Phenotype Fish Figures
cell centrosome position, abnormal WT + MO2-plk1 Fig. 3 with image from Jeong et al., 2010
cell centrosome variability of size, abnormal WT + MO2-plk1 Fig. 3 with image from Jeong et al., 2010
cell mitotic spindle disorganized, abnormal WT + MO2-plk1 Fig. 3 with image from Jeong et al., 2010
chromosome condensation increased occurrence, abnormal WT + MO2-plk1 Fig. 4 with image from Jeong et al., 2010
integument fragile, abnormal WT + MO2-plk1 Fig. 2 with image from Jeong et al., 2010
median fin fold apoptotic, abnormal WT + MO2-plk1 Fig. 2 with image from Jeong et al., 2010
mitotic cell cycle, embryonic disrupted, abnormal snu1Tg + MO2-plk1 Fig. 3 with image,  Fig. 5 with image from Jeong et al., 2010
mitotic centrosome separation disrupted, abnormal WT + MO2-plk1 Fig. 3 with image from Jeong et al., 2010
mitotic metaphase chromosome alignment disrupted, abnormal snu1Tg + MO2-plk1 Fig. 3 with image,  Fig. 5 with image from Jeong et al., 2010
mitotic prometaphase arrested, abnormal WT + MO2-plk1 Fig. 3 with image from Jeong et al., 2010
mitotic sister chromatid separation disrupted, abnormal WT + MO2-plk1 Fig. 4 with image,  Fig. 5 with image from Jeong et al., 2010
mitotic spindle assembly disrupted, abnormal WT + MO2-plk1 Fig. 3 with image from Jeong et al., 2010
spinal cord apoptotic, abnormal WT + MO2-plk1 Fig. 2 with image from Jeong et al., 2010
tail bud apoptotic, abnormal WT + MO2-plk1 Fig. 2 with image from Jeong et al., 2010
whole organism decreased size, abnormal WT + MO2-plk1 Fig. 2 with image from Jeong et al., 2010
Phenotype of all Fish created by or utilizing MO2-plk1
Phenotype Fish Conditions Figures
tail bud apoptotic, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
spinal cord apoptotic, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
mitotic cell cycle, embryonic disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
integument fragile, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
cell centrosome position, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
chromosome condensation increased occurrence, abnormal WT + MO2-plk1 standard conditions Fig. 4 with image from Jeong et al., 2010
cell mitotic spindle disorganized, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
whole organism decreased size, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
mitotic centrosome separation disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
median fin fold apoptotic, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
cell centrosome variability of size, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
mitotic sister chromatid separation disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 4 with image from Jeong et al., 2010
mitotic prometaphase arrested, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
mitotic metaphase chromosome alignment disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
mitotic spindle assembly disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
mitotic cell cycle, embryonic disrupted, abnormal snu1Tg + MO2-plk1 standard conditions Fig. 5 with image from Jeong et al., 2010
mitotic sister chromatid separation disrupted, abnormal snu1Tg + MO2-plk1 standard conditions Fig. 5 with image from Jeong et al., 2010
mitotic metaphase chromosome alignment disrupted, abnormal snu1Tg + MO2-plk1 standard conditions Fig. 5 with image from Jeong et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.