Morpholino

MO2-esr1

ID
ZDB-MRPHLNO-100624-3
Name
MO2-esr1
Previous Names
None
Target
Sequence
5' - AGGAAGGTTCCTCCAGGGCTTCTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-esr1
No data available
Phenotype
Phenotype resulting from MO2-esr1
Phenotype of all Fish created by or utilizing MO2-esr1
Phenotype Fish Conditions Figures
whole organism vtg1 expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: 17alpha-ethynylestradiol Fig. 5 from Bertotto et al., 2018
whole organism drd1b expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: 17alpha-ethynylestradiol Fig. 6 from Bertotto et al., 2018
whole organism drd1b expression decreased amount, abnormal SPF 5-D + MO2-esr1 control Fig. 6 from Bertotto et al., 2018
whole organism mao expression decreased amount, abnormal SPF 5-D + MO2-esr1 control Fig. 7 from Bertotto et al., 2018
whole organism comtb expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: 17alpha-ethynylestradiol Fig. 7 from Bertotto et al., 2018
whole organism vtg1 expression decreased amount, abnormal SPF 5-D + MO2-esr1 control Fig. 5 from Bertotto et al., 2018
whole organism drd1b expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: bifenthrin Fig. 6 from Bertotto et al., 2018
whole organism comtb expression decreased amount, abnormal SPF 5-D + MO2-esr1 control Fig. 7 from Bertotto et al., 2018
whole organism vtg1 expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: bifenthrin Fig. 5 from Bertotto et al., 2018
whole organism mao expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: 17alpha-ethynylestradiol Fig. 7 from Bertotto et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO2-esr1 chemical treatment by environment: 17beta-estradiol Fig. 2 with image from Carroll et al., 2014
trunk somite GFP expression increased amount, abnormal u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: bisphenol A Fig. 3 from Moreman et al., 2018
liver GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: bisphenol A Fig. 3 from Moreman et al., 2018
heart GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: 17-alpha-Ethinylestradiol Fig. 3 from Moreman et al., 2018
caudal fin somite GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: bisphenol A Fig. 3 from Moreman et al., 2018
heart GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: 4-Methyl-2,4-bis-(p-hydroxyphenyl)pent-1-ene Fig. 3 from Moreman et al., 2018
liver GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: 17-alpha-Ethinylestradiol Fig. 3 from Moreman et al., 2018
trunk somite GFP expression increased amount, abnormal u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: 17-alpha-Ethinylestradiol Fig. 3 from Moreman et al., 2018
trunk somite GFP expression increased amount, abnormal u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: 4-Methyl-2,4-bis-(p-hydroxyphenyl)pent-1-ene Fig. 3 from Moreman et al., 2018
liver GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: 4-Methyl-2,4-bis-(p-hydroxyphenyl)pent-1-ene Fig. 3 from Moreman et al., 2018
caudal fin somite GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: 17-alpha-Ethinylestradiol Fig. 3 from Moreman et al., 2018
heart GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: bisphenol A Fig. 3 from Moreman et al., 2018
caudal fin somite GFP expression amount, ameliorated u300Tg/u300Tg; uex3Tg/uex3Tg + MO2-esr1 chemical treatment by environment: 4-Methyl-2,4-bis-(p-hydroxyphenyl)pent-1-ene Fig. 3 from Moreman et al., 2018
Citations