Morpholino

MO3-lrrk2

ID
ZDB-MRPHLNO-100520-6
Name
MO3-lrrk2
Previous Names
None
Target
Sequence
5' - ACAACTCCTCTATTTCTGCCATGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to translation-start
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-lrrk2
Expressed Gene Anatomy Figures
lrrk2 Fig. 1 with image,  Fig. 6 with image from Prabhudesai et al., 2016
Fig. 3 with image from Sheng et al., 2010
sod1 Fig. 7 with image from Prabhudesai et al., 2016
Phenotype
Phenotype resulting from MO3-lrrk2
Phenotype Fish Figures
brain lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 Fig. 6 with image from Prabhudesai et al., 2016
brain has fewer parts of type dopaminergic neuron, abnormal AB + MO3-lrrk2 Fig. 5 with image from Prabhudesai et al., 2016
brain has fewer parts of type neuron, abnormal AB + MO3-lrrk2 Fig. 5 with image from Prabhudesai et al., 2016
diencephalon Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 8 with image from Prabhudesai et al., 2016
eye decreased size, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
eye edematous, abnormal AB + MO3-lrrk2 + MO4-tp53 Fig. 3 with image from Prabhudesai et al., 2016
eye malformed, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
hindbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 8 with image from Prabhudesai et al., 2016
lens edematous, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
midbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 8 with image from Prabhudesai et al., 2016
optic fissure open, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
otic vesicle edematous, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 + MO4-tp53 Fig. 1 with image,  Fig. 3 with image,  Fig. 5 with image from Prabhudesai et al., 2016
post-vent region cell death increased occurrence, abnormal AB + MO3-lrrk2 Fig. 5 with image from Prabhudesai et al., 2016
postoptic commissure Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 8 with image from Prabhudesai et al., 2016
pronephric duct apicolateral plasma membrane ab1-atp1a1 labeling mislocalised, abnormal AB + MO3-lrrk2 Fig. 9 with image from Prabhudesai et al., 2016
pronephric duct kidney epithelium development process quality, abnormal AB + MO3-lrrk2 Fig. 9 with image from Prabhudesai et al., 2016
spinal cord has fewer parts of type neuron, abnormal AB + MO3-lrrk2 Fig. 5 with image from Prabhudesai et al., 2016
whole organism lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
whole organism Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 7 with image from Prabhudesai et al., 2016
whole organism sod1 expression increased amount, abnormal AB + MO3-lrrk2 Fig. 7 with image from Prabhudesai et al., 2016
whole organism Ab1-htra2 labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 7 with image from Prabhudesai et al., 2016
Phenotype of all Fish created by or utilizing MO3-lrrk2
Phenotype Fish Conditions Figures
pronephric duct kidney epithelium development process quality, abnormal AB + MO3-lrrk2 standard conditions Fig. 9 with image from Prabhudesai et al., 2016
whole organism lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
diencephalon Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
otic vesicle edematous, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
whole organism Ab1-htra2 labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
postoptic commissure Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
pronephric duct apicolateral plasma membrane ab1-atp1a1 labeling mislocalised, abnormal AB + MO3-lrrk2 standard conditions Fig. 9 with image from Prabhudesai et al., 2016
eye malformed, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
midbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
whole organism Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
lens edematous, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
brain lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 6 with image from Prabhudesai et al., 2016
whole organism sod1 expression increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
post-vent region cell death increased occurrence, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
spinal cord has fewer parts of type neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
hindbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
brain has fewer parts of type neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image,  Fig. 5 with image from Prabhudesai et al., 2016
optic fissure open, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
brain has fewer parts of type dopaminergic neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
eye decreased size, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
eye edematous, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.