Morpholino

MO3-fgf4

ID

ZDB-MRPHLNO-100511-1

Name

MO3-fgf4

Previous Names

fgf4 MO1 (1)

Target

fgf4 (1)

Sequence

5' - TTTCATACTCACAGATCCGTAAAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-fgf4

No data available

Phenotype

Phenotype resulting from MO3-fgf4

Phenotype	Fish	Figures
brain decreased size, abnormal	WT + MO3-fgf4	Fig. 1 from Yamauchi et al., 2009
determination of heart left/right asymmetry disrupted, abnormal	WT + MO3-fgf4	Fig. 2 , Fig. 5 from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal	WT + MO3-fgf4	Fig. 2 from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal	WT + MO3-fgf4	Fig. 2 from Yamauchi et al., 2009
heart mislocalised, abnormal	WT + MO3-fgf4	Fig. 2 from Yamauchi et al., 2009
heart development disrupted, abnormal	WT + MO3-fgf4	Fig. 5 from Yamauchi et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal	WT + MO3-fgf4	Fig. 4 from Yamauchi et al., 2009
liver mislocalised, abnormal	WT + MO3-fgf4	Fig. 2 from Yamauchi et al., 2009
pancreas mislocalised, abnormal	WT + MO3-fgf4	Fig. 2 from Yamauchi et al., 2009
pericardium edematous, abnormal	WT + MO3-fgf4	Fig. 1 from Yamauchi et al., 2009
trunk bent, abnormal	WT + MO3-fgf4	Fig. 1 from Yamauchi et al., 2009

Phenotype of all Fish created by or utilizing MO3-fgf4

Phenotype	Fish	Conditions	Figures
heart mislocalised, abnormal	WT + MO3-fgf4	standard conditions	Fig. 2 from Yamauchi et al., 2009
pancreas mislocalised, abnormal	WT + MO3-fgf4	standard conditions	Fig. 2 from Yamauchi et al., 2009
trunk bent, abnormal	WT + MO3-fgf4	standard conditions	Fig. 1 from Yamauchi et al., 2009
brain decreased size, abnormal	WT + MO3-fgf4	standard conditions	Fig. 1 from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal	WT + MO3-fgf4	standard conditions	Fig. 2 from Yamauchi et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal	WT + MO3-fgf4	standard conditions	Fig. 4 from Yamauchi et al., 2009
determination of heart left/right asymmetry disrupted, abnormal	WT + MO3-fgf4	standard conditions	Fig. 2 , Fig. 5 from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal	WT + MO3-fgf4	standard conditions	Fig. 2 from Yamauchi et al., 2009
pericardium edematous, abnormal	WT + MO3-fgf4	standard conditions	Fig. 1 from Yamauchi et al., 2009
heart development disrupted, abnormal	WT + MO3-fgf4	standard conditions	Fig. 5 from Yamauchi et al., 2009
liver mislocalised, abnormal	WT + MO3-fgf4	standard conditions	Fig. 2 from Yamauchi et al., 2009
pancreas mislocalised, abnormal	WT + MO3-fgf4 + MO3-fgf8a	standard conditions	Fig. 2 from Yamauchi et al., 2009
liver mislocalised, abnormal	WT + MO3-fgf4 + MO3-fgf8a	standard conditions	Fig. 2 from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal	WT + MO3-fgf4 + MO3-fgf8a	standard conditions	Fig. 2 from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal	WT + MO3-fgf4 + MO3-fgf8a	standard conditions	Fig. 2 from Yamauchi et al., 2009

Citations