Morpholino
MO1-esr2a
- ID
- ZDB-MRPHLNO-100503-20
- Name
- MO1-esr2a
- Previous Names
- None
- Target
- Sequence
-
5' - ACATGGTGAAGGCGGATGAGTTCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-esr2a
No data available
Phenotype
Phenotype resulting from MO1-esr2a
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-esr2a
1 - 5 of 12 Show all
Citations
- Chaturantabut, S., Shwartz, A., Garnaas, M.K., LaBella, K., Li, C.C., Carroll, K.J., Cutting, C.C., Budrow, N., Palaria, A., Gorelick, D.A., Tremblay, K.D., North, T.E., Goessling, W. (2020) Estrogen acts via estrogen receptor 2b to regulate hepatobiliary fate during vertebrate development. Hepatology (Baltimore, Md.). 72(5):1786-1799
- Chaturantabut, S., Shwartz, A., Evason, K.J., Cox, A.G., Labella, K., Schepers, A.G., Yang, S., Aravena, M., Houvras, Y., Mancio-Silva, L., Romano, S., Gorelick, D.A., Cohen, D.E., Zon, L.I., Bhatia, S.N., North, T.E., Goessling, W. (2019) Estrogen Activation of G protein-coupled Estrogen Receptor 1 Regulates Phosphoinositide 3-kinase and mTOR Signaling to Promote Liver Growth in Zebrafish and Proliferation of Human Hepatocytes. Gastroenterology. 156(6):1788-1804.e13
- Carroll, K.J., Esain, V., Garnaas, M.K., Cortes, M., Dovey, M.C., Nissim, S., Frechette, G.M., Liu, S.Y., Kwan, W., Cutting, C.C., Harris, J.M., Gorelick, D.A., Halpern, M.E., Lawson, N.D., Goessling, W., North, T.E. (2014) Estrogen defines the dorsal-ventral limit of VEGF regulation to specify the location of the hemogenic endothelial niche. Developmental Cell. 29:437-53
- Gorelick, D.A., Iwanowicz, L.R., Hung, A.L., Blazer, V.S., and Halpern, M.E. (2014) Transgenic Zebrafish Reveal Tissue-Specific Differences in Estrogen Signaling in Response to Environmental Water Samples. Environmental health perspectives. 122(4):356-62
- Froehlicher, M., Liedtke, A., Groh, K., Lopez-Schier, H., Neuhauss, S.C., Segner, H., and Eggen, R.I. (2009) Estrogen receptor subtype beta2 is involved in neuromast development in zebrafish (Danio rerio) larvae. Developmental Biology. 330(1):32-43
1 - 5 of 5
Show