Morpholino

MO2-prnpb

ID
ZDB-MRPHLNO-100423-5
Name
MO2-prnpb
Previous Names
  • prp1-2 MO (1)
Target
Sequence
5' - GGTCCATAAAAAGGTTGAAGAAGCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prnpb
No data available
Phenotype
Phenotype resulting from MO2-prnpb
Phenotype of all Fish created by or utilizing MO2-prnpb
Phenotype Fish Conditions Figures
whole organism ab2-ctnnb labeling amount, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 1 with image,  Fig. 4 with image from Sempou et al., 2016
endocytosis increased occurrence, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image from Sempou et al., 2016
whole organism ab2-ctnnb labeling decreased amount, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image,  Fig. 4 with image from Sempou et al., 2016
epiboly arrested, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: chloroquine Fig. 1 with image from Sempou et al., 2016
DEL cytosol ab2-ctnnb labeling mislocalised, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image,  Fig. 3 with image from Sempou et al., 2016
blastoderm thickness, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 1 with image from Sempou et al., 2016
DEL intracellular anatomical structure ab2-ctnnb labeling mislocalised, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image,  Fig. 3 with image from Sempou et al., 2016
blastoderm thickness, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: chloroquine Fig. 1 with image from Sempou et al., 2016
epiboly arrested, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: dynasore Fig. 1 with image from Sempou et al., 2016
epiboly arrested, abnormal WT + MO1-prnpb + MO2-prnpb standard conditions Fig. 1 with image,  Fig. 2 with image from Sempou et al., 2016
blastoderm thickness, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: ammonium chloride Fig. 1 with image from Sempou et al., 2016
whole organism ab2-ctnnb labeling amount, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: chloroquine Fig. 1 with image,  Fig. 4 with image from Sempou et al., 2016
DEL cell surface ab2-ctnnb labeling position, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: dynasore Fig. 1 with image from Sempou et al., 2016
epiboly arrested, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: ammonium chloride Fig. 1 with image from Sempou et al., 2016
blastoderm thickness, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: dynasore Fig. 1 with image from Sempou et al., 2016
blastoderm increased thickness, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image from Sempou et al., 2016
epiboly arrested, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 1 with image from Sempou et al., 2016
DEL adherens junction disorganized, abnormal WT + MO2-prnpb standard conditions Fig. 6 with image from Málaga-Trillo et al., 2009
DEL increased accumulation DEL cytoplasmic vesicle, abnormal WT + MO2-prnpb standard conditions Fig. 6 with image from Málaga-Trillo et al., 2009
calcium-independent cell-cell adhesion disrupted, abnormal WT + MO2-prnpb standard conditions Fig. 5 with image from Málaga-Trillo et al., 2009
cell-cell adhesion disrupted, abnormal WT + MO2-prnpb standard conditions Fig. 4 with image from Málaga-Trillo et al., 2009
DEL cell circular, abnormal WT + MO2-prnpb standard conditions Fig. 4 with image from Málaga-Trillo et al., 2009
DEL cell disorganized, abnormal WT + MO2-prnpb standard conditions Fig. 4 with image from Málaga-Trillo et al., 2009
gastrulation arrested, abnormal WT + MO2-prnpb standard conditions Fig. 2 with image from Málaga-Trillo et al., 2009
Citations