Morpholino

MO1-nkx2.7

ID
ZDB-MRPHLNO-090826-13
Name
MO1-nkx2.7
Previous Names
  • anti-nkx2.7 ATG MO (1)
Target
Sequence
5' - TGGAGGTCACAGGACTCGGAAGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nkx2.7
Expressed Gene Anatomy Figures
myh6 Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Targoff et al., 2013
myh7 Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Targoff et al., 2013
Phenotype
Phenotype resulting from MO1-nkx2.7
Phenotype Fish Figures
atrial myocardium disorganized, abnormal WT + MO1-nkx2.7 Fig. 5 with image from Targoff et al., 2013
atrial myocardium increased size, abnormal WT + MO1-nkx2.7 Fig. 6 with image from Targoff et al., 2013
atrial myocardium increased width, abnormal WT + MO1-nkx2.7 Fig. 5 with image from Targoff et al., 2013
atrial myocardium swollen, abnormal WT + MO1-nkx2.7 Fig. 6 with image from Targoff et al., 2013
atrial myocardium cardiac muscle cell loose, abnormal WT + MO1-nkx2.7 Fig. 5 with image from Targoff et al., 2013
atrium shape, abnormal WT + MO1-nkx2.7 Fig. 1 with image from Targoff et al., 2008
cardiac ventricle decreased size, abnormal WT + MO1-nkx2.7 Fig. 1 with image from Targoff et al., 2008
heart morphology, abnormal WT + MO1-nkx2.7 Fig. 3 with image from Targoff et al., 2013
ventricular myocardium decreased size, abnormal WT + MO1-nkx2.7 Fig. 6 with image from Targoff et al., 2013
ventricular myocardium decreased width, abnormal WT + MO1-nkx2.7 Fig. 5 with image from Targoff et al., 2013
ventricular myocardium increased width, abnormal WT + MO1-nkx2.7 Fig. 6 with image from Targoff et al., 2013
ventricular myocardium shortened, abnormal WT + MO1-nkx2.7 Fig. 5 with image from Targoff et al., 2013
ventricular myocardium cardiac muscle cell condensed, abnormal WT + MO1-nkx2.7 Fig. 5 with image from Targoff et al., 2013
Phenotype of all Fish created by or utilizing MO1-nkx2.7
Phenotype Fish Conditions Figures
ventricular myocardium decreased size, abnormal WT + MO1-nkx2.7 standard conditions Fig. 6 with image from Targoff et al., 2013
ventricular myocardium shortened, abnormal WT + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
atrial myocardium swollen, abnormal WT + MO1-nkx2.7 standard conditions Fig. 6 with image from Targoff et al., 2013
atrial myocardium disorganized, abnormal WT + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
atrial myocardium cardiac muscle cell loose, abnormal WT + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
atrium shape, abnormal WT + MO1-nkx2.7 standard conditions Fig. 1 with image from Targoff et al., 2008
ventricular myocardium cardiac muscle cell condensed, abnormal WT + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
heart morphology, abnormal WT + MO1-nkx2.7 standard conditions Fig. 3 with image from Targoff et al., 2013
atrial myocardium increased width, abnormal WT + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
cardiac ventricle decreased size, abnormal WT + MO1-nkx2.7 standard conditions Fig. 1 with image from Targoff et al., 2008
atrial myocardium increased size, abnormal WT + MO1-nkx2.7 standard conditions Fig. 6 with image from Targoff et al., 2013
ventricular myocardium decreased width, abnormal WT + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
ventricular myocardium increased width, abnormal WT + MO1-nkx2.7 standard conditions Fig. 6 with image from Targoff et al., 2013
atrial myocardium dilated, abnormal nkx2.5vu179/+ + MO1-nkx2.7 standard conditions Fig. 3 with image from Targoff et al., 2013
ventricular myocardium shortened, abnormal nkx2.5vu179/vu179 + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
ventricular myocardium decreased size, abnormal nkx2.5vu179/vu179 + MO1-nkx2.7 standard conditions Fig. 5 with image,  Fig. 6 with image from Targoff et al., 2013
atrial myocardium cardiac muscle cell loose, abnormal nkx2.5vu179/vu179 + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
ventricular myocardium cardiac muscle cell condensed, abnormal nkx2.5vu179/vu179 + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
atrial myocardium distended, abnormal nkx2.5vu179/vu179 + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
ventricular myocardium hypoplastic, abnormal nkx2.5vu179/vu179 + MO1-nkx2.7 standard conditions Fig. 3 with image from Targoff et al., 2013
ventricular myocardium increased width, abnormal nkx2.5vu179/vu179 + MO1-nkx2.7 standard conditions Fig. 5 with image from Targoff et al., 2013
atrial myocardium increased size, abnormal nkx2.5vu179/vu179 + MO1-nkx2.7 standard conditions Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Targoff et al., 2013
lateral mesoderm isl1a expression increased distribution, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Witzel et al., 2012
atrium increased size, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
heart tube shape, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
atrium increased width, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
muscle cell migration delayed, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 3 with image from Targoff et al., 2008
atrium spherical, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
mandibular arch skeleton decreased size, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
pericardium edematous, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
atrium cardiac muscle cell isl1a expression increased distribution, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Witzel et al., 2012
cardiac ventricle decreased size, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
tube formation disrupted, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 4 with image from Targoff et al., 2008
cardiac ventricle increased width, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
embryonic heart tube development disrupted, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image,  Fig. 6 with image from Targoff et al., 2008
heart looping disrupted, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
cardiac ventricle decreased length, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
ventricular system swollen, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
heart tube morphology, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 6 with image from Targoff et al., 2008
atrial myocardium cardiac muscle cell increased amount, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 6 with image from Targoff et al., 2008
heart contraction decreased intensity, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
heart primordium isl1a expression increased distribution, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Witzel et al., 2012
cardiac ventricle circular, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
atrial myocardium cardiac muscle cell increased amount, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
cardiac ventricle decreased size, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
atrium increased size, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
embryonic heart tube development disrupted, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
ventricular myocardium cardiac muscle cell decreased amount, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.