Morpholino

MO2-gmnn

ID
ZDB-MRPHLNO-090520-1
Name
MO2-gmnn
Previous Names
  • GemMO (1)
Target
Sequence
5' - CTTTGGTCTTCTGATGGAACTCATA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gmnn
No data available
Phenotype
Phenotype resulting from MO2-gmnn
Phenotype Fish Figures
apoptotic process decreased occurrence, abnormal AB + MO2-gmnn Fig. 3 from Liu et al., 2009
apoptotic process increased occurrence, abnormal twu34Tg + MO2-gmnn Fig. 2 from Huang et al., 2011
axis decreased length, abnormal AB + MO2-gmnn Fig. 2Fig. 6 from Liu et al., 2009
cell migration involved in gastrulation disrupted, abnormal AB + MO2-gmnn Fig. 2Fig. 6 from Liu et al., 2009
convergent extension involved in gastrulation disrupted, abnormal AB + MO2-gmnn Fig. 2 from Liu et al., 2009
delamination involved in gastrulation with mouth forming second disrupted, abnormal AB + MO2-gmnn text only from Liu et al., 2009
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO2-gmnn Fig. 1Fig. 2Fig. 4 from Huang et al., 2011
determination of liver left/right asymmetry disrupted, abnormal gz15Tg + MO2-gmnn Fig. 1Fig. 4 from Huang et al., 2011
determination of pancreatic left/right asymmetry disrupted, abnormal gz15Tg + MO2-gmnn Fig. 1Fig. 4 from Huang et al., 2011
eye decreased distance eye, abnormal AB + MO2-gmnn Fig. S4 from Liu et al., 2009
eye fused with eye, abnormal AB + MO2-gmnn Fig. S4 from Liu et al., 2009
gastrulation with mouth forming second disrupted, abnormal AB + MO2-gmnn Fig. 1 from Liu et al., 2009
heart mislocalised radially, abnormal twu34Tg + MO2-gmnn + MO4-tp53 Fig. 1Fig. 2Fig. 4 from Huang et al., 2011
hypoblast decreased thickness, abnormal AB + MO2-gmnn text only from Liu et al., 2009
Kupffer's vesicle malformed, abnormal AB + MO2-gmnn Fig. 4 from Huang et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal AB + MO2-gmnn Fig. 4 from Huang et al., 2011
Kupffer's vesicle development disrupted, abnormal AB + MO2-gmnn Fig. 4 from Huang et al., 2011
liver mislocalised radially, abnormal gz15Tg + MO2-gmnn Fig. 1Fig. 4 from Huang et al., 2011
neural plate morphology, abnormal AB + MO2-gmnn Fig. 7 from Liu et al., 2009
neural plate development disrupted, abnormal AB + MO2-gmnn Fig. 7 from Liu et al., 2009
pancreas mislocalised radially, abnormal gz15Tg + MO2-gmnn Fig. 1Fig. 4 from Huang et al., 2011
pancreas primordium Ab8-ins labeling increased amount, abnormal AB + MO2-gmnn Fig. 4 with imageFig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling increased amount, abnormal AB + MO2-gmnn Fig. 4 with imageFig. 5 with image from Yang et al., 2021
pancreas primordium cell cycle G1/S phase transition decreased process quality, abnormal s870Tg/s870Tg; w141Tg/w141Tg + MO2-gmnn Fig. 4 with image from Yang et al., 2021
regulation of mitotic cell cycle, embryonic disrupted, abnormal AB + MO2-gmnn Fig. 1 from Liu et al., 2009
whole organism lacks all parts of type Kupffer's vesicle, abnormal AB + MO2-gmnn Fig. 4 from Huang et al., 2011
Phenotype of all Fish created by or utilizing MO2-gmnn
Phenotype Fish Conditions Figures
endodermal cell fate commitment decreased process quality, abnormal cq40Tg/cq40Tg + MO2-gmnn ultraviolet light Fig. 4 with image from Yang et al., 2021
pancreas primordium cell cycle G1/S phase transition decreased process quality, abnormal cq40Tg/cq40Tg + MO2-gmnn ultraviolet light Fig. 4 with image from Yang et al., 2021
neural plate development disrupted, abnormal AB + MO2-gmnn standard conditions Fig. 7 from Liu et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO2-gmnn standard conditions Fig. 1 from Huang et al., 2011
whole organism lacks all parts of type Kupffer's vesicle, abnormal AB + MO2-gmnn standard conditions Fig. 4 from Huang et al., 2011
pancreas primordium ab2-isl labeling increased amount, abnormal AB + MO2-gmnn standard conditions Fig. 4 with imageFig. 5 with image from Yang et al., 2021
pancreas primordium Ab8-ins labeling increased amount, abnormal AB + MO2-gmnn standard conditions Fig. 4 with imageFig. 5 with image from Yang et al., 2021
eye decreased distance eye, abnormal AB + MO2-gmnn standard conditions Fig. S4 from Liu et al., 2009
apoptotic process decreased occurrence, abnormal AB + MO2-gmnn standard conditions Fig. 3 from Liu et al., 2009
eye fused with eye, abnormal AB + MO2-gmnn standard conditions Fig. S4 from Liu et al., 2009
pancreas mislocalised radially, abnormal AB + MO2-gmnn standard conditions Fig. 1 from Huang et al., 2011
hypoblast decreased thickness, abnormal AB + MO2-gmnn standard conditions text only from Liu et al., 2009
axis decreased length, abnormal AB + MO2-gmnn standard conditions Fig. 2Fig. 6 from Liu et al., 2009
Kupffer's vesicle malformed, abnormal AB + MO2-gmnn standard conditions Fig. 4 from Huang et al., 2011
regulation of mitotic cell cycle, embryonic disrupted, abnormal AB + MO2-gmnn standard conditions Fig. 1 from Liu et al., 2009
cell migration involved in gastrulation disrupted, abnormal AB + MO2-gmnn standard conditions Fig. 2Fig. 6 from Liu et al., 2009
delamination involved in gastrulation with mouth forming second disrupted, abnormal AB + MO2-gmnn standard conditions text only from Liu et al., 2009
Kupffer's vesicle cilium decreased amount, abnormal AB + MO2-gmnn standard conditions Fig. 4 from Huang et al., 2011
liver mislocalised radially, abnormal AB + MO2-gmnn standard conditions Fig. 1 from Huang et al., 2011
neural plate morphology, abnormal AB + MO2-gmnn standard conditions Fig. 7 from Liu et al., 2009
Kupffer's vesicle development disrupted, abnormal AB + MO2-gmnn standard conditions Fig. 4 from Huang et al., 2011
convergent extension involved in gastrulation disrupted, abnormal AB + MO2-gmnn standard conditions Fig. 2 from Liu et al., 2009
determination of liver left/right asymmetry disrupted, abnormal AB + MO2-gmnn standard conditions Fig. 1 from Huang et al., 2011
gastrulation with mouth forming second disrupted, abnormal AB + MO2-gmnn standard conditions Fig. 1 from Liu et al., 2009
liver mislocalised radially, abnormal gz15Tg + MO2-gmnn standard conditions Fig. 1Fig. 4 from Huang et al., 2011
pancreas mislocalised radially, abnormal gz15Tg + MO2-gmnn standard conditions Fig. 1Fig. 4 from Huang et al., 2011
determination of pancreatic left/right asymmetry disrupted, abnormal gz15Tg + MO2-gmnn standard conditions Fig. 1Fig. 4 from Huang et al., 2011
determination of liver left/right asymmetry disrupted, abnormal gz15Tg + MO2-gmnn standard conditions Fig. 1Fig. 4 from Huang et al., 2011
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO2-gmnn standard conditions Fig. 1Fig. 2Fig. 4 from Huang et al., 2011
apoptotic process increased occurrence, abnormal twu34Tg + MO2-gmnn standard conditions Fig. 2 from Huang et al., 2011
heart mislocalised radially, abnormal twu34Tg + MO2-gmnn standard conditions Fig. 1Fig. 2Fig. 4 from Huang et al., 2011
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO2-gmnn + MO4-tp53 standard conditions Fig. 2 from Huang et al., 2011
heart mislocalised radially, abnormal twu34Tg + MO2-gmnn + MO4-tp53 standard conditions Fig. 2 from Huang et al., 2011
pancreas primordium cell cycle G1/S phase transition decreased process quality, abnormal s870Tg/s870Tg; w141Tg/w141Tg + MO2-gmnn standard conditions Fig. 4 with image from Yang et al., 2021
pancreas primordium Ab8-ins labeling amount, ameliorated AB + MO1-shha + MO2-gmnn standard conditions Fig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling amount, ameliorated AB + MO1-shha + MO2-gmnn standard conditions Fig. 5 with image from Yang et al., 2021
Citations