Morpholino
MO4-six1b
- ID
- ZDB-MRPHLNO-081211-1
- Name
- MO4-six1b
- Previous Names
-
- UM (1)
- Target
- Sequence
-
5' - TCTCCTCTGGATGCTACGAAGGAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-six1b
No data available
Phenotype
Phenotype resulting from MO4-six1b
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO4-six1b
1 - 5 of 23 Show all
Citations
- O'Brien, J.H., Hernandez-Lagunas, L., Artinger, K.B., Ford, H.L. (2014) MicroRNA-30a regulates zebrafish myogenesis through targeting the transcription factor Six1. Journal of Cell Science. 127(Pt 10):2291-301
- Nord, H., Skalman, L.N., and von Hofsten, J. (2013) Six1 regulates proliferation of Pax7-positive muscle progenitors in zebrafish. Journal of Cell Science. 126(Pt 8):1868-80
- Lin, C.Y., Chen, W.T., Lee, H.C., Yang, P.H., Yang, H.J., and Tsai, H.J. (2009) The transcription factor six1a plays an essential role in the craniofacial myogenesis of zebrafish. Developmental Biology. 331(2):152-166
- Bessarab, D.A., Chong, S.W., Srinivas, B.P., and Korzh, V. (2008) Six1a is required for the onset of fast muscle differentiation in zebrafish. Developmental Biology. 323(2):216-228
1 - 4 of 4
Show