Morpholino

MO1-pdx1

ID
ZDB-MRPHLNO-080814-1
Name
MO1-pdx1
Previous Names
None
Target
Sequence
5' - GATAGTAATGCTCTTCCCGATTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pdx1
Phenotype
Phenotype resulting from MO1-pdx1
Phenotype Fish Figures
acinar cell decreased amount, abnormal WT + MO1-pdx1 Fig. 1 from Yee et al., 2001
blood vessel increased branchiness, abnormal y1Tg + MO1-pdx1 + MO4-tp53 Fig. 2 from Jörgens et al., 2015
blood vessel morphology, abnormal y1Tg + MO1-pdx1 + MO4-tp53 Fig. 2 from Jörgens et al., 2015
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO1-pdx1 Fig. 1 from Yee et al., 2001
determination of liver left/right asymmetry process quality, abnormal WT + MO1-pdx1 Fig. 1 from Yee et al., 2001
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO1-pdx1 Fig. 1 from Yee et al., 2001
digestive system positional polarity, abnormal WT + MO1-pdx1 Fig. 1 from Yee et al., 2001
endocrine pancreas EGFP expression decreased distribution, abnormal nl1Tg + MO1-pdx1 Fig. S10 from O'Hare et al., 2016
endocrine pancreas decreased functionality, abnormal WT + MO1-pdx1 Fig. 1 from Yee et al., 2001
endocrine pancreas decreased size, abnormal nl1Tg + MO1-pdx1 Fig. S10 from O'Hare et al., 2016
Fig. 3 with image from Kimmel et al., 2011
Fig. 1 from Yee et al., 2001
endocrine pancreas has fewer parts of type endodermal cell, abnormal m1018Tg; nl1Tg + MO1-pdx1 Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas hypoplastic, abnormal zf5Tg + MO1-pdx1 Fig. 6 from Jurczyk et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 Fig. S10 from O'Hare et al., 2016
Fig. 1 with imageFig. 3 with image from Kimmel et al., 2011
enteroendocrine cell differentiation disrupted, abnormal nl1Tg + MO1-pdx1 Fig. S10 from O'Hare et al., 2016
exocrine pancreas hypoplastic, abnormal WT + MO1-pdx1 Fig. 1 from Yee et al., 2001
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-pdx1 Fig. S15 from O'Hare et al., 2016
glucose metabolic process disrupted, abnormal zf5Tg + MO1-pdx1 Fig. 6 from Jurczyk et al., 2011
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-pdx1 Fig. 3 with image from Lou et al., 2020
intersegmental vessel morphology, abnormal y1Tg + MO1-pdx1 Fig. 3 with image from Lou et al., 2020
Fig. 2 from Jörgens et al., 2015
intersegmental vessel structure, abnormal y1Tg + MO1-pdx1 + MO4-tp53 Fig. 2 from Jörgens et al., 2015
ocular blood vessel has extra parts of type hyaloid vessel nucleus, abnormal ubs1Tg + MO1-pdx1 Fig. 3 from Wiggenhauser et al., 2020
ocular blood vessel sprouting angiogenesis increased process quality, abnormal y1Tg + MO1-pdx1 Fig. 4 with image from Lou et al., 2020
pancreas decreased size, abnormal ml2Tg + MO1-pdx1 Fig. 5 with image from Lou et al., 2020
pancreatic B cell decreased amount, abnormal WT + MO1-pdx1 Fig. 2 from O'Hare et al., 2016
Fig. 1 with imageFig. 3 with image from Kimmel et al., 2011
posterior pancreatic bud decreased size, abnormal WT + MO1-pdx1 Fig. 1 with image from Kimmel et al., 2011
pronephric glomerulus increased length, abnormal li1Tg + MO1-pdx1 Fig. 2 with image from Al-Dahmani et al., 2022
Fig. 4 from Wiggenhauser et al., 2022
pronephric glomerulus increased size, abnormal li1Tg + MO1-pdx1 Fig. 7 with image from She et al., 2017
pronephric glomerulus increased width, abnormal li1Tg + MO1-pdx1 Fig. 3 with imageFig. 6 with image from Sharma et al., 2016
pronephric podocyte podocyte development decreased process quality, abnormal li1Tg + MO1-pdx1 Fig. 5 with image from Sharma et al., 2016
pronephric podocyte podocyte foot dystrophic, abnormal li1Tg + MO1-pdx1 Fig. 5 with image from Sharma et al., 2016
pronephric podocyte podocyte foot malformed, abnormal li1Tg + MO1-pdx1 Fig. 5 with image from Sharma et al., 2016
pronephric tubule decreased length, abnormal li1Tg + MO1-pdx1 Fig. 2 with image from Al-Dahmani et al., 2022
Fig. 4 from Wiggenhauser et al., 2022
Fig. 10 from Schmöhl et al., 2019
Fig. 7 with image from She et al., 2017
Fig. 3 with imageFig. 6 with image from Sharma et al., 2016
pronephros renal filtration decreased occurrence, abnormal li1Tg + MO1-pdx1 Fig. 7 with image from She et al., 2017
Fig. 6 with image from Sharma et al., 2016
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO1-pdx1 Fig. 3 with imageFig. 6 with image from Sharma et al., 2016
renal glomerulus increased length, abnormal y1Tg + MO1-pdx1 Fig. 10 from Schmöhl et al., 2019
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 Fig. 3 with image from Kimmel et al., 2011
vasculature morphology, abnormal y1Tg + MO1-pdx1 Fig. 10 from Schmöhl et al., 2019
whole organism aldh7a1 expression decreased amount, abnormal WT + MO1-pdx1 Fig. S6 from Lou et al., 2020
whole organism ins expression decreased amount, abnormal WT + MO1-pdx1 Fig. 5 with image from Lou et al., 2020
whole organism aldh1l2 expression increased amount, abnormal WT + MO1-pdx1 Fig. S6 from Lou et al., 2020
whole organism aldh3a1 expression increased amount, abnormal WT + MO1-pdx1 Fig. S6 from Lou et al., 2020
whole organism aldh1a3 expression increased amount, abnormal WT + MO1-pdx1 Fig. S6 from Lou et al., 2020
whole organism aldh3b1 expression increased amount, abnormal WT + MO1-pdx1 Fig. S6 from Lou et al., 2020
whole organism ADP decreased amount, abnormal WT + MO1-pdx1 Fig. 7 with image from Lou et al., 2020
whole organism glucose increased amount, abnormal WT + MO1-pdx1 Fig. 7 with image from Lou et al., 2020
Fig. 9 from Schmöhl et al., 2019
Phenotype of all Fish created by or utilizing MO1-pdx1
Phenotype Fish Conditions Figures
whole organism ins expression decreased amount, abnormal WT + MO1-pdx1 standard conditions Fig. 5 with image from Lou et al., 2020
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
pancreatic B cell decreased amount, abnormal WT + MO1-pdx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
determination of liver left/right asymmetry process quality, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
whole organism aldh7a1 expression decreased amount, abnormal WT + MO1-pdx1 standard conditions Fig. S6 from Lou et al., 2020
acinar cell decreased amount, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
endocrine pancreas development disrupted, abnormal WT + MO1-pdx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
exocrine pancreas hypoplastic, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
endocrine pancreas decreased size, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
whole organism aldh1l2 expression increased amount, abnormal WT + MO1-pdx1 standard conditions Fig. S6 from Lou et al., 2020
digestive system positional polarity, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
posterior pancreatic bud decreased size, abnormal WT + MO1-pdx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
whole organism glucose increased amount, abnormal WT + MO1-pdx1 standard conditions Fig. 7 with image from Lou et al., 2020
Fig. 9 from Schmöhl et al., 2019
endocrine pancreas decreased functionality, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
whole organism aldh1a3 expression increased amount, abnormal WT + MO1-pdx1 standard conditions Fig. S6 from Lou et al., 2020
whole organism aldh3a1 expression increased amount, abnormal WT + MO1-pdx1 standard conditions Fig. S6 from Lou et al., 2020
whole organism aldh3b1 expression increased amount, abnormal WT + MO1-pdx1 standard conditions Fig. S6 from Lou et al., 2020
whole organism ADP decreased amount, abnormal WT + MO1-pdx1 standard conditions Fig. 7 with image from Lou et al., 2020
pronephric tubule length, ameliorated li1Tg + MO1-pdx1 chemical treatment by environment: Meclizine Fig. 4 from Wiggenhauser et al., 2022
pronephric tubule decreased length, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from Sharma et al., 2016
pronephric glomerulus increased length, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Meclizine Fig. 4 from Wiggenhauser et al., 2022
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 3 with imageFig. 6 with image from Sharma et al., 2016
pronephric glomerulus increased size, abnormal li1Tg + MO1-pdx1 control Fig. 7 with image from She et al., 2017
pronephros renal filtration decreased occurrence, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from Sharma et al., 2016
pronephric podocyte podocyte foot dystrophic, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 5 with image from Sharma et al., 2016
pronephric glomerulus increased width, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 3 with imageFig. 6 with image from Sharma et al., 2016
pronephros renal filtration decreased occurrence, abnormal li1Tg + MO1-pdx1 control Fig. 7 with image from She et al., 2017
Fig. 6 with image from Sharma et al., 2016
pronephric glomerulus length, ameliorated li1Tg + MO1-pdx1 chemical treatment by environment: thiosulfate Fig. 2 with image from Al-Dahmani et al., 2022
pronephric glomerulus increased width, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from Sharma et al., 2016
pronephric tubule decreased length, abnormal li1Tg + MO1-pdx1 control Fig. 2 with image from Al-Dahmani et al., 2022
Fig. 4 from Wiggenhauser et al., 2022
Fig. 7 with image from She et al., 2017
Fig. 3 with imageFig. 6 with image from Sharma et al., 2016
pronephric podocyte podocyte development decreased process quality, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 5 with image from Sharma et al., 2016
pronephric tubule length, ameliorated li1Tg + MO1-pdx1 chemical treatment by environment: thiosulfate Fig. 2 with image from Al-Dahmani et al., 2022
pronephric glomerulus increased length, abnormal li1Tg + MO1-pdx1 control Fig. 2 with image from Al-Dahmani et al., 2022
Fig. 4 from Wiggenhauser et al., 2022
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from Sharma et al., 2016
pronephric podocyte podocyte foot malformed, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 5 with image from Sharma et al., 2016
pancreas decreased size, abnormal ml2Tg + MO1-pdx1 standard conditions Fig. 5 with image from Lou et al., 2020
endocrine pancreas EGFP expression decreased distribution, abnormal nl1Tg + MO1-pdx1 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas decreased size, abnormal nl1Tg + MO1-pdx1 standard conditions Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal nl1Tg + MO1-pdx1 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-pdx1 standard conditions Fig. S10 from O'Hare et al., 2016
ocular blood vessel has extra parts of type hyaloid vessel nucleus, abnormal ubs1Tg + MO1-pdx1 standard conditions Fig. 3 from Wiggenhauser et al., 2020
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Lou et al., 2020
intersegmental vessel morphology, abnormal y1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Lou et al., 2020
pronephric tubule decreased length, abnormal y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
renal glomerulus increased length, abnormal y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
ocular blood vessel sprouting angiogenesis increased process quality, abnormal y1Tg + MO1-pdx1 standard conditions Fig. 4 with image from Lou et al., 2020
vasculature morphology, abnormal y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
intersegmental vessel morphology, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
intersegmental vessel structure, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
blood vessel increased branchiness, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
blood vessel morphology, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
endocrine pancreas hypoplastic, abnormal zf5Tg + MO1-pdx1 standard conditions Fig. 6 from Jurczyk et al., 2011
glucose metabolic process disrupted, abnormal zf5Tg + MO1-pdx1 standard conditions Fig. 6 from Jurczyk et al., 2011
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-pdx1 chemical treatment by environment: glucose Fig. S15 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-pdx1 control Fig. S15 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-pdx1 standard conditions Fig. 2 from O'Hare et al., 2016
response to glucose decreased process quality, abnormal jh1Tg; jh2Tg + MO1-pdx1 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-pdx1 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas decreased size, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas has fewer parts of type endodermal cell, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
whole organism ADP decreased amount, abnormal aldh3a1zf3260/zf3260 + MO1-pdx1 standard conditions Fig. 7 with image from Lou et al., 2020
whole organism ATP decreased amount, abnormal aldh3a1zf3260/zf3260 + MO1-pdx1 standard conditions Fig. 7 with image from Lou et al., 2020
whole organism glucose increased amount, exacerbated aldh3a1zf3260/zf3260 + MO1-pdx1 standard conditions Fig. 7 with image from Lou et al., 2020
whole organism glucose increased amount, abnormal cndp1zf3241/zf3241 + MO1-pdx1 standard conditions Fig. 9 from Schmöhl et al., 2019
whole organism glucose increased amount, abnormal cndp1zf3242/zf3242 + MO1-pdx1 standard conditions Fig. 9 from Schmöhl et al., 2019
whole organism glucose increased amount, abnormal cndp1zf3243/zf3243 + MO1-pdx1 standard conditions Fig. 9 from Schmöhl et al., 2019
pancreatic B cell absent, abnormal WT + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal WT + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
pancreatic B cell decreased amount, abnormal jh4Tg + MO1-pdx1 standard conditions Fig. 5 with image from Lou et al., 2020
pronephros renal filtration occurrence, ameliorated li1Tg + MO1-epoa + MO1-pdx1 control Fig. 7 with image from She et al., 2017
pronephric tubule decreased length, exacerbated li1Tg + MO1-epoa + MO1-pdx1 control Fig. 7 with image from She et al., 2017
pronephric glomerulus increased size, exacerbated li1Tg + MO1-epoa + MO1-pdx1 control Fig. 7 with image from She et al., 2017
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
posterior pancreatic bud elongated, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
posterior pancreatic bud cellular motility, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
ocular blood vessel sprouting angiogenesis increased process quality, exacerbated aldh3a1zf3260/zf3260; y1Tg + MO1-pdx1 standard conditions Fig. 4 with image from Lou et al., 2020
intersegmental vessel morphology, exacerbated aldh3a1zf3260/zf3260; y1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Lou et al., 2020
ocular blood vessel increased diameter, abnormal aldh3a1zf3260/zf3260; y1Tg + MO1-pdx1 standard conditions Fig. 4 with image from Lou et al., 2020
intersegmental vessel increased branchiness, exacerbated aldh3a1zf3260/zf3260; y1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Lou et al., 2020
vasculature morphology, abnormal cndp1zf3241/zf3241; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
pronephric tubule decreased length, abnormal cndp1zf3241/zf3241; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
renal glomerulus increased length, abnormal cndp1zf3241/zf3241; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
vasculature morphology, abnormal cndp1zf3242/zf3242; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
pronephric tubule decreased length, abnormal cndp1zf3242/zf3242; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
renal glomerulus increased length, abnormal cndp1zf3242/zf3242; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
pronephric tubule decreased length, abnormal cndp1zf3243/zf3243; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
renal glomerulus increased length, abnormal cndp1zf3243/zf3243; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
vasculature morphology, abnormal cndp1zf3243/zf3243; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
type B pancreatic cell differentiation absent, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
endocrine pancreas has fewer parts of type endodermal cell, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas decreased size, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
pancreatic B cell absent, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with imageFig. 3 with image from Kimmel et al., 2011
Citations