Morpholino
MO4-sox2
- ID
- ZDB-MRPHLNO-080329-2
- Name
- MO4-sox2
- Previous Names
-
- sox2-MO2 (1)
- Target
- Sequence
-
5' - GAGAGGCTGCTGAAGTTACCTTAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-sox2
No data available
Phenotype
Phenotype resulting from MO4-sox2
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO4-sox2
1 - 5 of 32 Show all
Citations
- Gao, M., Veil, M., Rosenblatt, M., Riesle, A.J., Gebhard, A., Hass, H., Buryanova, L., Yampolsky, L.Y., Grüning, B., Ulianov, S.V., Timmer, J., Onichtchouk, D. (2022) Pluripotency factors determine gene expression repertoire at zygotic genome activation. Nature communications. 13:788
- Chassaing, N., Davis, E.E., McKnight, K.L., Niederriter, A.R., Causse, A., David, V., Desmaison, A., Lamarre, S., Vincent-Delorme, C., Pasquier, L., Coubes, C., Lacombe, D., Rossi, M., Dufier, J.L., Dollfus, H., Kaplan, J., Katsanis, N., Etchevers, H.C., Faguer, S., Calvas, P. (2016) Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network. Genome research. 26(4):474-85
- Hagey, D.W., Zaouter, C., Combeau, G., Andersson Lendahl, M., Andersson, O., Huss, M., Muhr, J. (2016) Distinct transcription factor complexes act on a permissive chromatin landscape to establish regionalized gene expression in CNS stem cells. Genome research. 26(7):908-17
- Lee, M.T., Bonneau, A.R., Takacs, C.M., Bazzini, A.A., Divito, K.R., Fleming, E.S., and Giraldez, A.J. (2013) Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition. Nature. 503(7476):360-4
- Leichsenring, M., Maes, J., Mössner, R., Driever, W., and Onichtchouk, D. (2013) Pou5f1 transcription factor controls zygotic gene activation in vertebrates. Science (New York, N.Y.). 341(6149):1005-1009
- Okuda, Y., Ogura, E., Kondoh, H., and Kamachi, Y. (2010) B1 SOX coordinate cell specification with patterning and morphogenesis in the early zebrafish embryo. PLoS Genetics. 6:e1000936
- Kamachi, Y., Okuda, Y., and Kondoh, H. (2008) Quantitative assessment of the knockdown efficiency of morpholino antisense oligonucleotides in zebrafish embryos using a luciferase assay. Genesis (New York, N.Y. : 2000). 46(1):1-7
1 - 7 of 7
Show