Morpholino
MO1-cavin1b
- ID
- ZDB-MRPHLNO-080324-1
- Name
- MO1-cavin1b
- Previous Names
-
- MO1-ptrf
- MO1-ptrfb
- PTRF-MO (1)
- Target
- Sequence
-
5' - GACGGCTGTCTTCAATCACCTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cavin1b
No data available
Phenotype
Phenotype resulting from MO1-cavin1b
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-cavin1b
1 - 5 of 6 Show all
Citations
- Bessa, J., Luengo, M., Rivero-Gil, S., Ariza-Cosano, A., Maia, A.H., Ruiz-Ruano, F.J., Caballero, P., Naranjo, S., Carvajal, J.J., and Gómez-Skarmeta, J.L. (2014) A mobile insulator system to detect and disrupt cis-regulatory landscapes in vertebrates. Genome research. 24(3):487-95
- Shestopalov, I.A., Pitt, C.L., and Chen, J.K. (2012) Spatiotemporal resolution of the Ntla transcriptome in axial mesoderm development. Nature Chemical Biology. 8(3):270-276
- Hill, M.M., Bastiani, M., Luetterforst, R., Kirkham, M., Kirkham, A., Nixon, S.J., Walser, P., Abankwa, D., Oorschot, V.M., Martin, S., Hancock, J.F., and Parton, R.G. (2008) PTRF-Cavin, a Conserved Cytoplasmic Protein Required for Caveola Formation and Function. Cell. 132(1):113-124
1 - 3 of 3
Show