Morpholino

MO5-gcm2

ID
ZDB-MRPHLNO-080310-3
Name
MO5-gcm2
Previous Names
  • gcmb MO (1)
  • MO6-gcm2
Target
Sequence
5' - AAACTGATCTGAGGATTTGGACATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-gcm2
Phenotype
Phenotype resulting from MO5-gcm2
Phenotype of all Fish created by or utilizing MO5-gcm2
Phenotype Fish Conditions Figures
sodium ion import across plasma membrane increased occurrence, abnormal AB + MO5-gcm2 standard conditions Fig. 2 with image from Chang et al., 2013
sodium ion homeostasis disrupted, abnormal AB + MO5-gcm2 standard conditions Fig. 2 with image from Chang et al., 2013
NCC ionocyte increased amount, abnormal AB + MO5-gcm2 standard conditions Fig. 2 with image from Chang et al., 2013
ventral mandibular arch exserted, abnormal WT + MO5-gcm2 standard conditions Fig. 3 from Hanaoka et al., 2004
calcium ion homeostasis process quality, abnormal WT + MO5-gcm2 chemical treatment: cortisol Fig. 9 from Kumai et al., 2015
ceratohyal cartilage mislocalised ventrally, abnormal WT + MO5-gcm2 standard conditions Fig. 3 from Hanaoka et al., 2004
integument physical object quality, abnormal WT + MO5-gcm2 standard conditions Fig. 5 with image from Esaki et al., 2009
cartilage development disrupted, abnormal WT + MO5-gcm2 standard conditions Fig. 3 from Hanaoka et al., 2004
epithelial cell differentiation process quality, abnormal WT + MO5-gcm2 standard conditions Fig. 5 with image from Esaki et al., 2009
calcium ion homeostasis process quality, abnormal WT + MO5-gcm2 acidic Fig. 6 from Kumai et al., 2015
pharyngeal arch cartilage decreased size, abnormal WT + MO5-gcm2 standard conditions Fig. 3 from Hanaoka et al., 2004
palatoquadrate cartilage malformed, abnormal WT + MO5-gcm2 standard conditions Fig. 3 from Hanaoka et al., 2004
ceratobranchial cartilage decreased size, abnormal WT + MO5-gcm2 standard conditions Fig. 3 from Hanaoka et al., 2004
basibranchial decreased size, abnormal WT + MO5-gcm2 standard conditions Fig. 3 from Hanaoka et al., 2004
calcium ion homeostasis process quality, abnormal WT + MO5-gcm2 standard conditions Fig. 1 from Kumai et al., 2015
Meckel's cartilage mislocalised ventrally, abnormal WT + MO5-gcm2 standard conditions Fig. 3 from Hanaoka et al., 2004
Citations