Morpholino

MO2-met

ID

ZDB-MRPHLNO-071219-2

Name

MO2-met

Previous Names

CM2 (1)

Target

met (1)

Sequence

5' - CTGTAAAATAAAGACACCTGTCGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-met

Expressed Gene	Anatomy	Figures
foxa3	ectoderm liver	Fig. 7 from Li et al., 2010

Phenotype

Phenotype resulting from MO2-met

Phenotype	Fish	Figures
endoderm decreased size, abnormal	WT + MO2-met	Fig. 7 from Li et al., 2010
liver decreased size, abnormal	WT + MO2-met	Fig. 7 from Li et al., 2010
liver development disrupted, abnormal	WT + MO2-met	Fig. 7 from Li et al., 2010

Phenotype of all Fish created by or utilizing MO2-met

Phenotype	Fish	Conditions	Figures
musculoskeletal movement, spinal reflex action decreased rate, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 3 from Tallafuss et al., 2008
CaP motoneuron neurotransmitter mislocalised, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 8 from Tallafuss et al., 2008
motor neuron axon decreased length, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 5 from Tallafuss et al., 2008
CaP motoneuron cellular biosynthetic process disrupted, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 8 from Tallafuss et al., 2008
cerebellum apoptotic process increased occurrence, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 9 from Tsai et al., 2015
CaP motoneuron axon decreased length, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 4 , Fig. 5 from Tallafuss et al., 2008
liver decreased size, abnormal	WT + MO2-met	standard conditions	Fig. 7 from Li et al., 2010
liver development disrupted, abnormal	WT + MO2-met	standard conditions	Fig. 7 from Li et al., 2010
endoderm decreased size, abnormal	WT + MO2-met	standard conditions	Fig. 7 from Li et al., 2010
floor plate secondary motor neuron decreased amount, abnormal	zf35Tg + MO1-met + MO2-met	standard conditions	Fig. 6 from Tallafuss et al., 2008
liver decreased size, abnormal	zf235Tg + MO2-met	standard conditions	Fig. 7 from Li et al., 2010
liver development disrupted, abnormal	zf235Tg + MO2-met	standard conditions	Fig. 7 from Li et al., 2010
CaP motoneuron axon misrouted, abnormal	parga^mn2Et + MO1-met + MO2-met	standard conditions	Fig. 9 from Tallafuss et al., 2008
CaP motoneuron axon increased amount, abnormal	parga^mn2Et + MO1-met + MO2-met	standard conditions	Fig. 9 from Tallafuss et al., 2008

Citations