Morpholino
MO2-cxcr4a
- ID
- ZDB-MRPHLNO-071022-1
- Name
- MO2-cxcr4a
- Previous Names
-
- Cr4a-1-MO (1)
- Target
- Sequence
-
5' - ATAAGCCATCTCTAAAAGACTTCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cxcr4a
No data available
Phenotype
Phenotype resulting from MO2-cxcr4a
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO2-cxcr4a
1 - 5 of 21 Show all
Citations
- Lin, C.Y., He, J.Y., Zeng, C.W., Loo, M.R., Chang, W.Y., Zhang, P.H., Tsai, H.J. (2017) microRNA-206 modulates an Rtn4a/Cxcr4a/Thbs3a axis in newly forming somites to maintain and stabilize the somite boundary formation of zebrafish embryos.. Open Biology. 7(7)
- Boer, E.F., Howell, E.D., Schilling, T.F., Jette, C.A., Stewart, R.A. (2015) Fascin1-Dependent Filopodia are Required for Directional Migration of a Subset of Neural Crest Cells. PLoS Genetics. 11:e1004946
- Olesnicky Killian, E.C., Birkholz, D.A., and Artinger, K.B. (2009) A role for chemokine signaling in neural crest cell migration and craniofacial development. Developmental Biology. 333(1):161-172
- Chong, S.W., Nguyet, L.M., Jiang, Y.J., and Korzh, V. (2007) The chemokine, Sdf-1, and its receptor, Cxcr4, are required for formation of muscle in zebrafish. BMC Developmental Biology. 7(1):54
1 - 4 of 4
Show