Morpholino

MO2-cxcr4a

ID
ZDB-MRPHLNO-071022-1
Name
MO2-cxcr4a
Previous Names
  • Cr4a-1-MO (1)
Target
Sequence
5' - ATAAGCCATCTCTAAAAGACTTCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cxcr4a
Expressed Gene Anatomy Figures
myf5 Fig. 2 with image,  Fig. S2 with image from Chong et al., 2007
mylpfa Fig. 2 with image from Chong et al., 2007
myod1 Fig. 2 with image,  Fig. S2 with image from Chong et al., 2007
th Fig. S9 with image from Boer et al., 2015
thbs3a Fig. 5 with image from Lin et al., 2017
Phenotype
Phenotype resulting from MO2-cxcr4a
Phenotype Fish Figures
cranial neural crest filopodium decreased length, abnormal vu234Tg + MO2-cxcr4a Fig. 8 with image from Boer et al., 2015
muscle cell development disrupted, abnormal WT + MO2-cxcr4a Fig. 2 with image from Chong et al., 2007
myofibril assembly disrupted, abnormal WT + MO2-cxcr4a Fig. 4 with image from Chong et al., 2007
skeletal muscle tissue development disrupted, abnormal gz5Tg/+ + MO2-cxcr4a Fig. 3 with image from Chong et al., 2007
somite thbs3a expression increased amount, abnormal AB + MO2-cxcr4a Fig. 5 with image from Lin et al., 2017
somite thbs3a expression increased distribution, abnormal AB + MO2-cxcr4a Fig. 5 with image from Lin et al., 2017
somite morphology, abnormal WT + MO2-cxcr4a Fig. 2 with image from Chong et al., 2007
somite border malformed, abnormal AB + MO2-cxcr4a Fig. 4 with image from Lin et al., 2017
somite border morphology, abnormal AB + MO2-cxcr4a Fig. 4 with image,  Fig. 5 with image from Lin et al., 2017
somite border centrosome spatial pattern, abnormal AB + MO2-cxcr4a Fig. 6 with image from Lin et al., 2017
somite border epithelial cell morphology, abnormal AB + MO2-cxcr4a Fig. 6 with image from Lin et al., 2017
somite border mesenchymal to epithelial transition decreased occurrence, abnormal AB + MO2-cxcr4a Fig. 6 with image from Lin et al., 2017
whole organism thbs3a expression increased amount, abnormal AB + MO2-cxcr4a Fig. 5 with image from Lin et al., 2017
Phenotype of all Fish created by or utilizing MO2-cxcr4a
Phenotype Fish Conditions Figures
somite border centrosome spatial pattern, abnormal AB + MO2-cxcr4a standard conditions Fig. 6 with image from Lin et al., 2017
somite border malformed, abnormal AB + MO2-cxcr4a standard conditions Fig. 4 with image from Lin et al., 2017
somite border morphology, abnormal AB + MO2-cxcr4a standard conditions Fig. 4 with image,  Fig. 5 with image from Lin et al., 2017
somite border epithelial cell morphology, abnormal AB + MO2-cxcr4a standard conditions Fig. 6 with image from Lin et al., 2017
somite border mesenchymal to epithelial transition decreased occurrence, abnormal AB + MO2-cxcr4a standard conditions Fig. 6 with image from Lin et al., 2017
somite thbs3a expression increased distribution, abnormal AB + MO2-cxcr4a standard conditions Fig. 5 with image from Lin et al., 2017
somite thbs3a expression increased amount, abnormal AB + MO2-cxcr4a standard conditions Fig. 5 with image from Lin et al., 2017
whole organism thbs3a expression increased amount, abnormal AB + MO2-cxcr4a standard conditions Fig. 5 with image from Lin et al., 2017
muscle cell development disrupted, abnormal WT + MO2-cxcr4a standard conditions Fig. 2 with image from Chong et al., 2007
myofibril assembly disrupted, abnormal WT + MO2-cxcr4a standard conditions Fig. 4 with image from Chong et al., 2007
somite morphology, abnormal WT + MO2-cxcr4a standard conditions Fig. 2 with image from Chong et al., 2007
skeletal muscle tissue development disrupted, abnormal gz5Tg/+ + MO2-cxcr4a standard conditions Fig. 3 with image from Chong et al., 2007
cranial neural crest filopodium decreased length, abnormal vu234Tg + MO2-cxcr4a standard conditions Fig. 8 with image from Boer et al., 2015
somite morphology, abnormal cxcr4bt26035/t26035 + MO2-cxcr4a standard conditions Fig. S2 with image from Chong et al., 2007
splanchnocranium morphology, abnormal fscn1azd1011/zd1011 + MO2-cxcr4a standard conditions Fig. 8 with image from Boer et al., 2015
sympathetic nervous system development process quality, abnormal fscn1azd1011/zd1011 + MO2-cxcr4a standard conditions Fig. S9 with image from Boer et al., 2015
somite border morphology, ameliorated AB + MO1-thbs3a + MO2-cxcr4a standard conditions Fig. 5 with image from Lin et al., 2017
whole organism thbs3a expression increased amount, abnormal AB + MO2-cxcr4a + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
whole organism thbs3a expression increased amount, abnormal AB + MO15-rtn4a + MO2-cxcr4a standard conditions Fig. 5 with image from Lin et al., 2017
cranial neural crest filopodium decreased length, abnormal fscn1azd1012/zd1012; vu234Tg + MO2-cxcr4a standard conditions Fig. 8 with image from Boer et al., 2015
cranial neural crest filopodium decreased amount, abnormal fscn1azd1012/zd1012; vu234Tg + MO2-cxcr4a standard conditions Fig. 8 with image from Boer et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.