Morpholino

MO1-dll4

ID
ZDB-MRPHLNO-070509-1
Name
MO1-dll4
Previous Names
None
Target
Sequence
5' - GTTCGAGCTTACCGGCCACCCAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dll4
Phenotype
Phenotype resulting from MO1-dll4
Phenotype of all Fish created by or utilizing MO1-dll4
Phenotype Fish Conditions Figures
whole organism uxt expression increased amount, abnormal AB + MO1-dll4 standard conditions Fig. 5 from Zhou et al., 2015
dorsal aorta decreased diameter, abnormal WT + MO1-dll4 standard conditions Fig. 4 from Bridge et al., 2012
blood vessel development disrupted, abnormal WT + MO1-dll4 standard conditions Fig. S8 with image from Sacilotto et al., 2013
whole organism tm4sf18 expression increased amount, abnormal WT + MO1-dll4 standard conditions Fig. 3 from Page et al., 2019
dorsal aorta tm4sf18 expression increased distribution, abnormal WT + MO1-dll4 standard conditions Fig. 3 from Page et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-dll4 standard conditions Fig. 6 with image from Bonkhofer et al., 2019
whole organism kdrl expression increased amount, abnormal WT + MO1-dll4 standard conditions Fig. 3 from Page et al., 2019
intersegmental vein blood vessel endothelial cell increased amount, abnormal ubs1Tg + MO1-dll4 standard conditions Fig. 2 from Page et al., 2019
blood vessel endothelial cell cell division increased duration, abnormal ubs1Tg + MO1-dll4 standard conditions Fig. 2 from Page et al., 2019
intersegmental artery structure, abnormal y1Tg + MO1-dll4 standard conditions Fig. S1 from Siekmann et al., 2007
blood circulation disrupted, abnormal y1Tg + MO1-dll4 standard conditions Fig. S1 from Siekmann et al., 2007
intersegmental artery blood vessel endothelial cell increased amount, abnormal y7Tg + MO1-dll4 standard conditions Fig. 4Fig. S7 from Siekmann et al., 2007
dorsal longitudinal anastomotic vessel morphology, ameliorated y1Tg + MO1-dll4 + MO1-ptger3 standard conditions Fig. 3 from Chen et al., 2017
intersegmental vessel sprouting angiogenesis occurrence, ameliorated y1Tg + MO1-dll4 + MO1-ptger3 standard conditions Fig. 3 from Chen et al., 2017
intersegmental vessel morphology, ameliorated y1Tg + MO1-dll4 + MO1-ptger3 standard conditions Fig. 3 from Chen et al., 2017
intersegmental vessel normal length, ameliorated s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell normal amount, ameliorated s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
Citations