Morpholino
MO1-fyna,fynb
- ID
- ZDB-MRPHLNO-070304-3
- Name
- MO1-fyna,fynb
- Previous Names
-
- Fyn-MO (1)
- MO1-fyna+fynb
- Targets
- Sequence
-
5' - TGTCCTTACATTGCACACAGCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino targets 2 genes.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fyna,fynb
No data available
Phenotype
Phenotype resulting from MO1-fyna,fynb
No data available
Phenotype of all Fish created by or utilizing MO1-fyna,fynb
1 - 5 of 19 Show all
Citations
- Sempou, E., Biasini, E., Pinzón-Olejua, A., Harris, D.A., Málaga-Trillo, E. (2016) Activation of zebrafish Src family kinases by the prion protein is an amyloid-β-sensitive signal that prevents the endocytosis and degradation of E-cadherin/β-catenin complexes in vivo. Molecular neurodegeneration. 11:18
- Czopka, T., Ffrench-Constant, C., and Lyons, D.A. (2013) Individual Oligodendrocytes Have Only a Few Hours in which to Generate New Myelin Sheaths In Vivo. Developmental Cell. 25(6):599-609
- Lemeer, S., Jopling, C., Gouw, J.W., Mohammed, S., Heck, A.J., Slijper, M., and den Hertog, J. (2008) Comparative phosphoproteomics of zebrafish Fyn/Yes morpholino knockdown embryos. Molecular & cellular proteomics : MCP. 7(11):2176-2187
- Jopling, C., and den Hertog, J. (2007) Essential role for Csk upstream of Fyn and Yes in zebrafish gastrulation. Mechanisms of Development. 124(2):129-136
- Jopling, C., van Geemen, D., and den Hertog, J. (2007) Shp2 Knockdown and Noonan/LEOPARD Mutant Shp2-Induced Gastrulation Defects. PLoS Genetics. 3(12):e225
- Lemeer, S., Jopling, C., Naji, F., Ruijtenbeek, R., Slijper, M., Heck, A.J., and den Hertog, J. (2007) Protein-tyrosine kinase activity profiling in knock down zebrafish embryos. PLoS One. 2(1):e581
- Jopling, C., and den Hertog, J. (2005) Fyn/Yes and non-canonical Wnt signalling converge on RhoA in vertebrate gastrulation cell movements. EMBO reports. 6(5):426-431
1 - 7 of 7
Show