Morpholino

MO1-sim1a

ID
ZDB-MRPHLNO-060921-2
Name
MO1-sim1a
Previous Names
None
Target
Sequence
5' - TCGACTTCTCCTTCATGCTCTACGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to translation-start
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sim1a
Expressed Gene Anatomy Figures
avp Fig. 5 with image from Eaton et al., 2008
dlx2a Fig. 7 with image from Eaton et al., 2006
nkx2.2a Fig. 7 with image from Eaton et al., 2006
nkx2.4b Fig. 7 with image from Eaton et al., 2006
oxt Fig. 6 with image from Eaton et al., 2006
pou3f2a Fig. 3 from Kasher et al., 2016
pou3f2b Fig. 3 from Kasher et al., 2016
shha Fig. 7 with image from Eaton et al., 2006
sim1a Fig. 6 with image from Eaton et al., 2006
slc12a1 Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. S6 with image from Cheng et al., 2015
slc12a3 Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. S6 with image from Cheng et al., 2015
slc20a1a Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image,  Fig. 6 with image,  Fig. S6 with image from Cheng et al., 2015
stc1 Fig. 3 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. S6 with image from Cheng et al., 2015
trpm7 Fig. 7 with image from Poureetezadi et al., 2016
Fig. 3 with image,  Fig. 6 with image,  Fig. S6 with image from Cheng et al., 2015
Phenotype
Phenotype resulting from MO1-sim1a
Phenotype Fish Figures
corpuscles of Stannius stc1 expression absent, abnormal TU + MO1-sim1a Fig. 3 with image from Cheng et al., 2015
embryo development delayed, abnormal WT + MO1-sim1a Fig. 6 with image,  Fig. 7 with image from Eaton et al., 2006
eye decreased size, abnormal WT + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
Fig. 5 with image from Eaton et al., 2008
Fig. 6 with image,  Fig. 7 with image from Eaton et al., 2006
head apoptotic, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
head decreased size, abnormal WT + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
Fig. 5 with image from Eaton et al., 2008
Fig. 6 with image,  Fig. 7 with image from Eaton et al., 2006
heart edematous, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
neuroendocrine cell decreased amount, abnormal WT + MO1-sim1a Fig. 5 with image from Eaton et al., 2006
preoptic area pou3f2b expression decreased amount, abnormal WT + MO1-sim1a Fig. 3 from Kasher et al., 2016
preoptic area pou3f2a expression decreased amount, abnormal WT + MO1-sim1a Fig. 3 from Kasher et al., 2016
preoptic area morphology, abnormal WT + MO1-sim1a Fig. 5 with image from Eaton et al., 2008
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-sim1a Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a Fig. 6 with image,  Fig. 7 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a Fig. 3 with image,  Fig. 6 with image,  Fig. S6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-sim1a Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal TU + MO1-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal TU + MO1-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule straight, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal TU + MO1-sim1a Fig. 7 with image from Poureetezadi et al., 2016
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO1-sim1a Fig. 7 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal TU + MO1-sim1a Fig. 3 with image,  Fig. S6 with image from Cheng et al., 2015
pronephric proximal tubule development decreased process quality, abnormal TU + MO1-sim1a + MO1-tp53 Fig. S6 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-sim1a Fig. 2 with image,  Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal TU + MO1-sim1a Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a + MO1-tp53 Fig. 6 with image,  Fig. S6 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a Fig. 3 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. S6 with image from Cheng et al., 2015
renal filtration decreased process quality, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
Phenotype of all Fish created by or utilizing MO1-sim1a
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-sim1a control Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
heart edematous, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric distal early tubule mislocalised posteriorly, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric distal late tubule increased length, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image,  Fig. S6 with image from Cheng et al., 2015
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-sim1a control Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased length, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric distal early tubule slc12a1 expression spatial pattern, ameliorated TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric distal early tubule mislocalised anteriorly, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a standard conditions Fig. 6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image,  Fig. 6 with image,  Fig. S6 with image from Cheng et al., 2015
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
renal filtration decreased process quality, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal TU + MO1-sim1a standard conditions Fig. 7 with image from Poureetezadi et al., 2016
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. S6 with image from Cheng et al., 2015
head apoptotic, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
eye decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule straight, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a standard conditions Fig. 6 with image,  Fig. 7 with image from Cheng et al., 2015
head decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image,  Fig. 3 with image from Cheng et al., 2015
corpuscles of Stannius stc1 expression absent, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO1-sim1a standard conditions Fig. 7 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric distal early tubule increased length, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal tubule development decreased process quality, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
embryo development delayed, abnormal WT + MO1-sim1a standard conditions Fig. 6 with image,  Fig. 7 with image from Eaton et al., 2006
preoptic area pou3f2a expression decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 3 from Kasher et al., 2016
eye decreased size, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
Fig. 6 with image,  Fig. 7 with image from Eaton et al., 2006
head decreased size, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
Fig. 6 with image,  Fig. 7 with image from Eaton et al., 2006
neuroendocrine cell decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2006
preoptic area pou3f2b expression decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 3 from Kasher et al., 2016
preoptic area morphology, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.