Morpholino
MO2-isl1a
- ID
- ZDB-MRPHLNO-060728-1
- Name
- MO2-isl1a
- Previous Names
-
- islet1E2 (1)
- MO2-isl1
- Target
- Sequence
-
5' - TTAATCTGCGTTACCTGATGTAGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-isl1a
No data available
Phenotype
Phenotype resulting from MO2-isl1a
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO2-isl1a
1 - 5 of 17 Show all
Citations
- Abu Nahia, K., Migdał, M., Quinn, T.A., Poon, K.L., Łapiński, M., Sulej, A., Liu, J., Mondal, S.S., Pawlak, M., Bugajski, Ł., Piwocka, K., Brand, T., Kohl, P., Korzh, V., Winata, C. (2021) Genomic and physiological analyses of the zebrafish atrioventricular canal reveal molecular building blocks of the secondary pacemaker region. Cellular and molecular life sciences : CMLS. 78(19-20):6669-6687
- Colombo, S., de Sena-Tomás, C., George, V., Werdich, A.A., Kapur, S., MacRae, C.A., Targoff, K.L. (2017) nkx genes establish SHF cardiomyocyte progenitors at the arterial pole and pattern the venous pole through Isl1 repression. Development (Cambridge, England). 145(3)
- Seredick, S., Hutchinson, S.A., Van Ryswyk, L., Talbot, J.C., Eisen, J.S. (2014) Lhx3 and Lhx4 suppress Kolmer-Agduhr interneuron characteristics within zebrafish axial motoneurons. Development (Cambridge, England). 141(20):3900-9
- Wang, L., Mongera, A., Bonanomi, D., Cyganek, L., Pfaff, S.L., Nüsslein-Volhard, C., Marquardt, T. (2014) A conserved axon type hierarchy governing peripheral nerve assembly. Development (Cambridge, England). 141:1875-83
- Hoffmann, S., Berger, I.M., Glaser, A., Bacon, C., Li, L., Gretz, N., Steinbeisser, H., Rottbauer, W., Just, S., and Rappold, G. (2013) Islet1 is a direct transcriptional target of the homeodomain transcription factor Shox2 and rescues the Shox2-mediated bradycardia. Basic Research in Cardiology. 108(2):339
- Filippi, A., Jainok, C., and Driever, W. (2012) Analysis of transcriptional codes for zebrafish dopaminergic neurons reveals essential functions of Arx and Isl1 in prethalamic dopaminergic neuron development. Developmental Biology. 369(1):133-149
- Seredick, S., Van Ryswyk, L., Hutchinson, S.A., and Eisen, J.S. (2012) Zebrafish Mnx proteins specify one motoneuron subtype and suppress acquisition of interneuron characteristics. Neural Development. 7(1):35
- Lim, A.H., Suli, A., Yaniv, K., Weinstein, B., Li, D.Y., and Chien, C.B. (2011) Motoneurons are essential for vascular pathfinding. Development (Cambridge, England). 138(17):3847-3857
- de Pater, E., Clijsters, L., Marques, S.R., Lin, Y.F., Garavito-Aguilar, Z.V., Yelon, D., and Bakkers, J. (2009) Distinct phases of cardiomyocyte differentiation regulate growth of the zebrafish heart. Development (Cambridge, England). 136(10):1633-1641
- Hutchinson, S.A., and Eisen, J.S. (2006) Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity. Development (Cambridge, England). 133(11):2137-2147
1 - 10 of 10
Show