Morpholino
MO1-dvl2
- ID
- ZDB-MRPHLNO-060724-1
- Name
- MO1-dvl2
- Previous Names
-
- dsh 2 MO (1)
- Target
- Sequence
-
5' - TAAATTATCTTGGTCTCCGCCATGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dvl2
No data available
Phenotype
Phenotype resulting from MO1-dvl2
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-dvl2
1 - 5 of 28 Show all
Citations
- Merks, A.M., Swinarski, M., Meyer, A.M., Müller, N.V., Özcan, I., Donat, S., Burger, A., Gilbert, S., Mosimann, C., Abdelilah-Seyfried, S., Panáková, D. (2018) Planar cell polarity signalling coordinates heart tube remodelling through tissue-scale polarisation of actomyosin activity. Nature communications. 9:2161
- Shimizu, N., Ishitani, S., Sato, A., Shibuya, H., Ishitani, T. (2014) Hipk2 and PP1c Cooperate to Maintain Dvl Protein Levels Required for Wnt Signal Transduction. Cell Reports. 8(5):1391-404
- Mahuzier, A., Gaudé, H.M., Grampa, V., Anselme, I., Silbermann, F., Leroux-Berger, M., Delacour, D., Ezan, J., Montcouquiol, M., Saunier, S., Schneider-Maunoury, S., and Vesque, C. (2012) Dishevelled stabilization by the ciliopathy protein Rpgrip1l is essential for planar cell polarity. The Journal of cell biology. 198(5):927-940
- Lum, W.M., Robertson, J.K., and Van Raay, T.J. (2011) Dishevelled2 is a stable protein during early zebrafish development. Zebrafish. 8(2):65-71
- Yang, Y., and Thorpe, C. (2011) BMP and non-canonical Wnt signaling are required for inhibition of secondary tail formation in zebrafish. Development (Cambridge, England). 138(12):2601-2611
- Zigman, M., Trinh, L.A., Fraser, S.E., and Moens, C.B. (2011) Zebrafish Neural Tube Morphogenesis Requires Scribble-Dependent Oriented Cell Divisions. Current biology : CB. 21(1):79-86
- Segalen, M., Johnston, C.A., Martin, C.A., Dumortier, J.G., Prehoda, K.E., David, N.B., Doe, C.Q., and Bellaiche, Y. (2010) The Fz-Dsh Planar Cell Polarity Pathway Induces Oriented Cell Division via Mud/NuMA in Drosophila and Zebrafish. Developmental Cell. 19(5):740-752
- Carreira-Barbosa, F., Kajita, M., Morel, V., Wada, H., Okamoto, H., Martinez Arias, A., Fujita, Y., Wilson, S.W., and Tada, M. (2009) Flamingo regulates epiboly and convergence/extension movements through cell cohesive and signalling functions during zebrafish gastrulation. Development (Cambridge, England). 136(3):383-392
- Tawk, M., Araya, C., Lyons, D.A., Reugels, A.M., Girdler, G.C., Bayley, P.R., Hyde, D.R., Tada, M., and Clarke, J.D. (2007) A mirror-symmetric cell division that orchestrates neuroepithelial morphogenesis. Nature. 446(7137):797-800
- Angers, S., Thorpe, C.J., Biechele, T.L., Goldenberg, S.J., Zheng, N., Maccoss, M.J., and Moon, R.T. (2006) The KLHL12-Cullin-3 ubiquitin ligase negatively regulates the Wnt-beta-catenin pathway by targeting Dishevelled for degradation. Nature cell biology. 8(4):348-357
1 - 10 of 10
Show