Morpholino
MO1-otx2b
- ID
- ZDB-MRPHLNO-060620-3
- Name
- MO1-otx2b
- Previous Names
-
- MO1-otx2
- Otx2 MO-Fluo (1)
- Target
- Sequence
-
5' - GTTGCTTGAGATACGACATCATGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-otx2b
No data available
Phenotype
Phenotype resulting from MO1-otx2b
No data available
Phenotype of all Fish created by or utilizing MO1-otx2b
1 - 5 of 15 Show all
Citations
- Staudt, N., Giger, F.A., Fielding, T., Hutt, J.A., Foucher, I., Snowden, V., Hellich, A., Kiecker, C., Houart, C. (2019) Pineal progenitors originate from a non-neural territory limited by FGF signalling. Development (Cambridge, England). 146(22):
- Albuixech-Crespo, B., López-Blanch, L., Burguera, D., Maeso, I., Sánchez-Arrones, L., Moreno-Bravo, J.A., Somorjai, I., Pascual-Anaya, J., Puelles, E., Bovolenta, P., Garcia-Fernàndez, J., Puelles, L., Irimia, M., Ferran, J.L. (2017) Molecular regionalization of the developing amphioxus neural tube challenges major partitions of the vertebrate brain. PLoS Biology. 15:e2001573
- Li, W.H., Zhou, L., Li, Z., Wang, Y., Shi, J.T., Yang, Y.J., Gui, J.F. (2015) Zebrafish Lbh-like Is Required for Otx2-mediated Photoreceptor Differentiation. International journal of biological sciences. 11(6):688-700
- Su, C.Y., Kemp, H.A., and Moens, C.B. (2014) Cerebellar development in the absence of Gbx function in zebrafish. Developmental Biology. 386(1):181-90
- Lane, B.M., and Lister, J.A. (2012) Otx but not mitf transcription factors are required for zebrafish retinal pigment epithelium development. PLoS One. 7(11):e49357
- Tseng, W.F., Jang, T.H., Huang, C.B., and Yuh, C.H. (2011) An evolutionarily conserved kernel of gata5, gata6, otx2 and prdm1a operates in the formation of endoderm in zebrafish. Developmental Biology. 357(2):541-57
- Scholpp, S., Foucher, I., Staudt, N., Peukert, D., Lumsden, A., and Houart, C. (2007) Otx1l, Otx2 and Irx1b establish and position the ZLI in the diencephalon. Development (Cambridge, England). 134(17):3167-3176
- Foucher, I., Mione, M., Simeone, A., Acampora, D., Bally-Cuif, L., and Houart, C. (2006) Differentiation of cerebellar cell identities in absence of Fgf signalling in zebrafish Otx morphants. Development (Cambridge, England). 133(10):1891-1900
1 - 8 of 8
Show