Morpholino

MO1-smyd1b

ID

ZDB-MRPHLNO-060524-9

Name

MO1-smyd1b

Previous Names

ATG-MO smyd1 (1)

Target

smyd1b

Sequence

5' - ACTTCCACAAACTCCATTCTGGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The sequence of this morpholino as reported by Tan, X. et al. (2006) contained a typographical error. The correct morpholino sequence, shown above, has been confirmed by the authors.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-smyd1b

No data available

Phenotype

Phenotype resulting from MO1-smyd1b

Phenotype	Fish	Figures
cardiac muscle cell Z disc disorganized, abnormal	WT + MO1-smyd1b	Fig. 4 from Li et al., 2013
cardiac muscle myosin thick filament assembly disrupted, abnormal	WT + MO1-smyd1b	Fig. 4 from Li et al., 2013
fast muscle cell M band disorganized, abnormal	WT + MO1-smyd1b	Fig. 2 from Li et al., 2013
fast muscle cell muscle thin filament assembly disrupted, abnormal	WT + MO1-smyd1b	Fig. 2 from Li et al., 2013
fast muscle cell sarcomere organization disrupted, abnormal	WT + MO1-smyd1b	Fig. 2 from Li et al., 2013
fast muscle cell striated muscle myosin thick filament assembly disrupted, abnormal	WT + MO1-smyd1b	Fig. 2 from Li et al., 2013
fast muscle cell Z disc disorganized, abnormal	WT + MO1-smyd1b	Fig. 2 from Li et al., 2013
skeletal muscle striated muscle thin filament disorganized, abnormal	WT + MO1-smyd1b	Fig. 4 from Gao et al., 2014
slow muscle cell myofibril assembly disrupted, abnormal	WT + MO1-smyd1b	Fig. 1 from Li et al., 2013
slow muscle cell myosin filament disorganized, abnormal	WT + MO1-smyd1b	Fig. 3 from Gao et al., 2014
slow muscle cell Z disc disorganized, abnormal	WT + MO1-smyd1b	Fig. 5 from Gao et al., 2014

Phenotype of all Fish created by or utilizing MO1-smyd1b

Phenotype	Fish	Conditions	Figures
fast muscle cell Z disc disorganized, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 2 from Li et al., 2013
slow muscle cell myosin filament disorganized, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 3 from Gao et al., 2014
skeletal muscle striated muscle thin filament disorganized, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 4 from Gao et al., 2014
fast muscle cell M band disorganized, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 2 from Li et al., 2013
fast muscle cell muscle thin filament assembly disrupted, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 2 from Li et al., 2013
slow muscle cell Z disc disorganized, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 5 from Gao et al., 2014
fast muscle cell striated muscle myosin thick filament assembly disrupted, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 2 from Li et al., 2013
slow muscle cell myofibril assembly disrupted, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 1 from Li et al., 2013
cardiac muscle myosin thick filament assembly disrupted, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 4 from Li et al., 2013
cardiac muscle cell Z disc disorganized, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 4 from Li et al., 2013
fast muscle cell sarcomere organization disrupted, abnormal	WT + MO1-smyd1b	standard conditions	Fig. 2 from Li et al., 2013
skeletal muscle striated muscle thin filament disorganized, abnormal	WT + MO1-smyd1a + MO1-smyd1b	standard conditions	Fig. 4 from Gao et al., 2014
slow muscle cell Z disc disorganized, abnormal	WT + MO1-smyd1a + MO1-smyd1b	standard conditions	Fig. 5 from Gao et al., 2014
slow muscle cell myosin filament disorganized, abnormal	WT + MO1-smyd1a + MO1-smyd1b	standard conditions	Fig. 3 from Gao et al., 2014
skeletal muscle cell EGFP expression spatial pattern, abnormal	mb19Tg + MO1-smyd1b	standard conditions	Fig. 6 from Li et al., 2019
skeletal muscle cell M band EGFP expression absent, abnormal	mb19Tg + MO1-smyd1b	standard conditions	Fig. 6 from Li et al., 2019

Citations