Morpholino
MO3-shhb
- ID
- ZDB-MRPHLNO-060508-2
- Name
- MO3-shhb
- Previous Names
- 
    
        
    
    
        
        - twhh-MO (1)
 
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - GCTTCAGATGCAGCCTTACGTCCAT - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            This is a subset of MO1-shhb, targeted to the translation start region.
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO3-shhb
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO3-shhb
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Figures | 
|---|---|---|
| blood circulation disrupted, abnormal | WIK + MO3-shhb | text only
                    
                    from Hammond et al., 2003 | 
| somite morphology, abnormal | WIK + MO3-shhb | text only
                    
                    from Hammond et al., 2003 | 
                
                    
                        Phenotype of all Fish created by or utilizing MO3-shhb
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
     
         ,
,