Morpholino

MO1-prickle1a

ID
ZDB-MRPHLNO-060209-7
Name
MO1-prickle1a
Previous Names
  • MO1-prickle1
  • pk1-Mo (1)
  • pk1aMOATG1 (1)
Target
Sequence
5' - GCCCACCGTGATTCTCCAGCTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-start blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prickle1a
Phenotype
Phenotype resulting from MO1-prickle1a
Phenotype Fish Figures
cardiac muscle cell orientation heart tube, abnormal WT + MO1-prickle1a Fig. 3 from Merks et al., 2018
cardiac muscle cell establishment of animal organ orientation process quality, abnormal WT + MO1-prickle1a Fig. 3 from Merks et al., 2018
cell migration involved in gastrulation disrupted, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
cell-cell adhesion disrupted, abnormal s870Tg + MO1-prickle1a Fig. 6 with image from Oteiza et al., 2010
convergent extension process quality, abnormal WT + MO1-prickle1a Fig. 1 with image from Dohn et al., 2013
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-prickle1a Fig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-prickle1a Fig. 2 with imageFig. 4 with image from Carreira-Barbosa et al., 2003
convergent extension involved in gastrulation process quality, abnormal WT + MO1-prickle1a Fig. 4 from Burcklé et al., 2011
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-prickle1a Fig. 6 from Jerber et al., 2014
fluid transport disrupted, abnormal WT + MO1-prickle1a Fig. 2 with image from Oteiza et al., 2010
forerunner cell group disorganized, abnormal s870Tg + MO1-prickle1a Fig. 4 with image from Oteiza et al., 2010
forerunner cell group increased width, abnormal s870Tg + MO1-prickle1a Fig. 4 with image from Oteiza et al., 2010
forerunner cell group malformed, abnormal s870Tg + MO1-prickle1a Fig. 4 with image from Oteiza et al., 2010
forerunner cell group shape, abnormal s870Tg + MO1-prickle1a Fig. 4 with image from Oteiza et al., 2010
head mesoderm increased width, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
heart looping disrupted, abnormal WT + MO1-prickle1a Fig. 3 with image from Oteiza et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-prickle1a Fig. 1 with imageFig. 2 with image from Oteiza et al., 2010
Kupffer's vesicle deformed, abnormal s870Tg + MO1-prickle1a Fig. 1 with imageFig. 2 with imageFig. 4 with image from Oteiza et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-prickle1a Fig. 2 with image from Oteiza et al., 2010
Kupffer's vesicle development disrupted, abnormal s870Tg + MO1-prickle1a Fig. 1 with imageFig. 2 with imageFig. 4 with image from Oteiza et al., 2010
neural plate increased width, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
neuron migration disrupted, abnormal rw0Tg + MO1-prickle1a Fig. 7 with image from Carreira-Barbosa et al., 2003
neuron projection morphogenesis disrupted, abnormal knu3Tg + MO1-prickle1a Fig. 4 with image from Mei et al., 2013
notochord decreased length, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
notochord increased width, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
post-vent region curved ventral, abnormal WT + MO1-prickle1a Fig. 2 with imageFig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region decreased length, abnormal WT + MO1-prickle1a Fig. 6 with image from Carreira-Barbosa et al., 2003
prechordal plate mislocalised posteriorly, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
pronephros cystic, abnormal WT + MO1-prickle1a Fig. 6 from Jerber et al., 2014
retinal inner plexiform layer disorganized, abnormal knu3Tg + MO1-prickle1a Fig. 4 with image from Mei et al., 2013
retinal inner plexiform layer synapse disorganized, abnormal knu3Tg + MO1-prickle1a Fig. 4 with image from Mei et al., 2013
rhombomere condensed, abnormal WT + MO1-prickle1a Fig. 6 with image from Carreira-Barbosa et al., 2003
segmental plate increased width, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
somite condensed, abnormal WT + MO1-prickle1a Fig. 6 with image from Carreira-Barbosa et al., 2003
somite decreased thickness, abnormal WT + MO1-prickle1a Fig. 4 with image from Carreira-Barbosa et al., 2003
somite increased width, abnormal WT + MO1-prickle1a Fig. 4 with imageFig. 6 with image from Carreira-Barbosa et al., 2003
spinal cord duplicated, abnormal WT + MO1-prickle1a Fig. S7 from Tawk et al., 2007
trunk condensed, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
whole organism curved ventral, abnormal AB/TU + MO1-prickle1a Fig. 3 with image from Kishimoto et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-prickle1a Fig. 4 with image from Carreira-Barbosa et al., 2003
Phenotype of all Fish created by or utilizing MO1-prickle1a
Phenotype Fish Conditions Figures
whole organism curved ventral, abnormal AB/TU + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
somite increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 4 with imageFig. 6 with image from Carreira-Barbosa et al., 2003
heart looping disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 3 with image from Oteiza et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Oteiza et al., 2010
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with imageFig. 4 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle deformed, abnormal WT + MO1-prickle1a standard conditions Fig. 1 with imageFig. 2 with image from Oteiza et al., 2010
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 6 from Jerber et al., 2014
cardiac muscle cell orientation heart tube, abnormal WT + MO1-prickle1a control Fig. 3 from Merks et al., 2018
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
post-vent region decreased length, abnormal WT + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
notochord decreased length, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
convergent extension involved in gastrulation process quality, abnormal WT + MO1-prickle1a standard conditions Fig. 4 from Burcklé et al., 2011
head mesoderm increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
somite condensed, abnormal WT + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
trunk condensed, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
cardiac muscle cell establishment of animal organ orientation process quality, abnormal WT + MO1-prickle1a control Fig. 3 from Merks et al., 2018
neural plate increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
cell migration involved in gastrulation disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle development disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 1 with imageFig. 2 with image from Oteiza et al., 2010
segmental plate increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
pronephros cystic, abnormal WT + MO1-prickle1a standard conditions Fig. 6 from Jerber et al., 2014
fluid transport disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Oteiza et al., 2010
somite decreased thickness, abnormal WT + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
notochord increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
spinal cord duplicated, abnormal WT + MO1-prickle1a standard conditions Fig. S7 from Tawk et al., 2007
rhombomere condensed, abnormal WT + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension process quality, abnormal WT + MO1-prickle1a standard conditions Fig. 1 with image from Dohn et al., 2013
post-vent region curved ventral, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with imageFig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
prechordal plate mislocalised posteriorly, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle decreased size, abnormal WT + MO1-prickle1a standard conditions Fig. 1 with imageFig. 2 with image from Oteiza et al., 2010
neuron projection morphogenesis disrupted, abnormal knu3Tg + MO1-prickle1a standard conditions Fig. 4 with image from Mei et al., 2013
retinal inner plexiform layer synapse disorganized, abnormal knu3Tg + MO1-prickle1a standard conditions Fig. 4 with image from Mei et al., 2013
retinal inner plexiform layer disorganized, abnormal knu3Tg + MO1-prickle1a standard conditions Fig. 4 with image from Mei et al., 2013
neuron migration disrupted, abnormal rw0Tg + MO1-prickle1a standard conditions Fig. 7 with image from Carreira-Barbosa et al., 2003
forerunner cell group shape, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
Kupffer's vesicle development disrupted, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
forerunner cell group increased width, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
forerunner cell group malformed, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
Kupffer's vesicle deformed, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
cell-cell adhesion disrupted, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 6 with image from Oteiza et al., 2010
forerunner cell group disorganized, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
somite condensed, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
rhombomere condensed, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region curved ventral, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension involved in axis elongation disrupted, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
somite increased width, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region decreased length, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region decreased length, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
rhombomere condensed, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension involved in axis elongation disrupted, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
somite increased width, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
somite condensed, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
somite condensed, abnormal wnt5bta98/ta98 + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
somite increased width, abnormal wnt5bta98/ta98 + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
convergent extension involved in gastrulation disrupted, abnormal wnt5bta98/ta98 + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
whole organism anterior-posterior axis decreased length, abnormal wnt5bta98/ta98 + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle development disrupted, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 1 with image from Oteiza et al., 2010
Kupffer's vesicle decreased size, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 1 with image from Oteiza et al., 2010
prechordal plate mislocalised posteriorly, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 3 with image from Carreira-Barbosa et al., 2003
heart looping disrupted, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 3 with image from Oteiza et al., 2010
convergent extension involved in gastrulation disrupted, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 3 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle deformed, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 1 with image from Oteiza et al., 2010
whole organism curved ventral, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 5 increased width, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism decreased length, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
somite increased width, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 3 increased width, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism decreased length, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 5 increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
somite increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism curved ventral, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 3 increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 + MO1-prickle1a standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-prickle1a + MO2-odad3 standard conditions Fig. 6 from Jerber et al., 2014
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-prickle1a + MO2-odad3 standard conditions Fig. 6 from Jerber et al., 2014
Kupffer's vesicle development disrupted, abnormal s870Tg; vu119Tg + MO1-prickle1a standard conditions Fig. 5 with image from Oteiza et al., 2010
Kupffer's vesicle deformed, abnormal s870Tg; vu119Tg + MO1-prickle1a standard conditions Fig. 5 with image from Oteiza et al., 2010
Kupffer's vesicle decreased size, abnormal s870Tg; vu119Tg + MO1-prickle1a standard conditions Fig. 5 with image from Oteiza et al., 2010
neuron migration disrupted, abnormal vangl2m209/+; rw0Tg + MO1-prickle1a standard conditions Fig. 7 with image from Carreira-Barbosa et al., 2003
Citations