Morpholino
MO1-prkci
- ID
- ZDB-MRPHLNO-060118-3
- Name
- MO1-prkci
- Previous Names
-
- hasMO (1)
- Target
- Sequence
-
5' - TGTCCCGCAGCGTGGGCATTATGGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prkci
No data available
Phenotype
Phenotype resulting from MO1-prkci
1 - 5 of 23 Show all
Phenotype of all Fish created by or utilizing MO1-prkci
1 - 5 of 55 Show all
Citations
- Raman, R., Damle, I., Rote, R., Banerjee, S., Dingare, C., Sonawane, M. (2016) aPKC regulates apical localization of Lgl to restrict elongation of microridges in developing zebrafish epidermis. Nature communications. 7:11643
- Strzyz, P.J., Lee, H.O., Sidhaye, J., Weber, I.P., Leung, L.C., Norden, C. (2015) Interkinetic Nuclear Migration Is Centrosome Independent and Ensures Apical Cell Division to Maintain Tissue Integrity. Developmental Cell. 32(2):203-19
- Gerlach, G.F., Wingert, R.A. (2014) Zebrafish pronephros tubulogenesis and epithelial identity maintenance are reliant on the polarity proteins Prkc iota and zeta. Developmental Biology. 396(2):183-200
- Krock, B.L., Perkins, B.D. (2014) The Par-PrkC Polarity Complex Is Required for Cilia Growth in Zebrafish Photoreceptors. PLoS One. 9:e104661
- Cibrián Uhalte, E., Kirchner, M., Hellwig, N., Allen, J.J., Donat, S., Shokat, K.M., Selbach, M., and Abdelilah-Seyfried, S. (2012) In vivo conditions to identify prkci phosphorylation targets using the analog-sensitive kinase method in zebrafish. PLoS One. 7(6):e40000
- Ohata, S., Aoki, R., Kinoshita, S., Yamaguchi, M., Tsuruoka-Kinoshita, S., Tanaka, H., Wada, H., Watabe, S., Tsuboi, T., Masai, I., and Okamoto, H. (2011) Dual Roles of Notch in Regulation of Apically Restricted Mitosis and Apicobasal Polarity of Neuroepithelial Cells. Neuron. 69(2):215-230
- Alexandre, P., Reugels, A.M., Barker, D., Blanc, E., and Clarke, J.D. (2010) Neurons derive from the more apical daughter in asymmetric divisions in the zebrafish neural tube. Nature Neuroscience. 13(6):673-679
- Garavito-Aguilar, Z.V., Riley, H.E., and Yelon, D. (2010) Hand2 ensures an appropriate environment for cardiac fusion by limiting Fibronectin function. Development (Cambridge, England). 137(19):3215-3220
- Grant, P.K., and Moens, C.B. (2010) The neuroepithelial basement membrane serves as a boundary and a substrate for neuron migration in the zebrafish hindbrain. Neural Development. 5:9
- Hava, D., Forster, U., Matsuda, M., Cui, S., Link, B.A., Eichhorst, J., Wiesner, B., Chitnis, A., and Abdelilah-Seyfried, S. (2009) Apical membrane maturation and cellular rosette formation during morphogenesis of the zebrafish lateral line. Journal of Cell Science. 122(Pt 5):687-695
1 - 10 of 18
Show