Morpholino
MO1-gna12a
- ID
- ZDB-MRPHLNO-060113-4
- Name
- MO1-gna12a
- Previous Names
-
- gna12-MO1 (1)
- MO1-gna12
- Target
- Sequence
-
5' - CGCACCACGCCAGCCATCCTGTCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gna12a
No data available
Phenotype
Phenotype resulting from MO1-gna12a
No data available
Phenotype of all Fish created by or utilizing MO1-gna12a
1 - 5 of 8 Show all
Citations
- Ackerman, S.D., Luo, R., Poitelon, Y., Mogha, A., Harty, B.L., D'Rozario, M., Sanchez, N.E., Lakkaraju, A.K.K., Gamble, P., Li, J., Qu, J., MacEwan, M.R., Ray, W.Z., Aguzzi, A., Feltri, M.L., Piao, X., Monk, K.R. (2018) GPR56/ADGRG1 regulates development and maintenance of peripheral myelin. The Journal of experimental medicine. 215(3):941-961
- Ackerman, S.D., Garcia, C., Piao, X., Gutmann, D.H., Monk, K.R. (2015) The adhesion GPCR Gpr56 regulates oligodendrocyte development via interactions with Gα12/13 and RhoA. Nature communications. 6:6122
- Li, P., Lahvic, J.L., Binder, V., Pugach, E.K., Riley, E.B., Tamplin, O.J., Panigrahy, D., Bowman, T.V., Barrett, F.G., Heffner, G.C., McKinney-Freeman, S., Schlaeger, T.M., Daley, G.Q., Zeldin, D.C., Zon, L.I. (2015) Epoxyeicosatrienoic acids enhance embryonic haematopoiesis and adult marrow engraftment. Nature. 523:468-71
- Ye, D., and Lin, F. (2013) S1pr2/Gα13 signaling controls myocardial migration by regulating endoderm convergence. Development (Cambridge, England). 140(4):789-799
- Lin, F., Chen, S., Sepich, D.S., Panizzi, J.R., Clendenon, S.G., Marrs, J.A., Hamm, H.E., and Solnica-Krezel, L. (2009) Galpha12/13 regulate epiboly by inhibiting E-cadherin activity and modulating the actin cytoskeleton. The Journal of cell biology. 184(6):909-921
- Lin, F., Sepich, D.S., Chen, S., Topczewski, J., Yin, C., Solnica-Krezel, L., and Hamm, H. (2005) Essential roles of G{alpha}12/13 signaling in distinct cell behaviors driving zebrafish convergence and extension gastrulation movements. The Journal of cell biology. 169(5):777-787
1 - 6 of 6
Show